Announcement

Collapse
No announcement yet.

Japan confirms 3 swine flu patients

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Japan confirms 3 swine flu patients

    Japan confirms 3 swine flu patients
    Source: http://mdn.mainichi.jp/mdnnews/news/...dm002000c.html

    TOKYO (AP) -- Japan confirmed its first cases of swine flu in three people who arrived in Tokyo from the U.S., a quarantine official said Saturday.

    The patients, who had been traveling in Canada, were among about 390 passengers that arrived in Tokyo's Narita International Airport on a flight from Detroit on Friday, an airport quarantine official said on condition of anonymity, citing department policy.

    They were quarantined after showing flu symptoms, and tested positive in a primary test on board, the official at the Narita Airport Quarantine said. They are recovering at a hospital near the airport.

    The two teenage male students and the teacher in his 40s had visited Canada's Ontario province on a home stay program since last month with about 30 other students, and returned to Tokyo via Detroit on a Northwest Airlines flight, Health and Welfare Minister Yoichi Masuzoe said in a televised news conference.

    The three participated in various programs hosted by a local high school in the town of Oakville since April 24. It was not immediately known if they were exposed to any swine flu cases during the trip.

    They tested positive for the influenza A virus, and later confirmed positive for the swine flu H1N1 strain in a DNA test at the National Institute of Infectious Diseases.

    Forty-nine other passengers who returned to Japan on the same flight and seated near the patients have been taken to a facility near the airport, where they will be monitored for 10 days.

    Masuzoe said the government was compiling addresses of the other travelers on the same flight to be able to respond quickly to people who may get sick.

    "There are limitations to what we can do, but we will continue to monitor the situation and strengthen or relax such measures as needed," he said.

    Japan has had tight quarantine control at the nation's main international airports, mobilizing hundreds of officials and doctors since last month in an attempt to prevent any cases of the disease.

    Masuzoe said that the effort paid off, but added that the government must be vigilant to keep the disease from spreading within Japan.

    Japan had previously been free of swine flu while the virus spread to several countries in Asia including Hong Kong and South Korea.

    A total of 44 people have died of the flu strain in Mexico, the epicenter of the disease, and two in the U.S. since the outbreak began last month.

    In Canada, a total of 242 cases of swine flu have been confirmed, nearly all have been mild, but a woman in her 30s died at a hospital in Alberta last month.

    __________________________
    SN1987A

  • #2
    Re: Japan confirms 3 swine flu patients

    Source: http://mdn.mainichi.jp/mdnnews/natio...na011000c.html

    11 airplane passengers at risk of swine flu not taken into quarantine

    Up to 11 passengers sitting close to a male high school student infected with swine flu on a flight from Canada entered Japan without being stopped in an onboard quarantine, it's been learned.

    Health, Labor and Welfare Minister Yoichi Masuzoe said on Saturday at an emergency news conference that the student, one of the three swine flu patients reported as Japan's first cases of the disease on Saturday, was allowed to get off the Northwest Airlines flight because he showed no signs of fever during the onboard medical inspection. After getting off the plane, however, the student complained of flu symptoms.


    Two other people on the plane were confirmed to have swine flu -- a male student and a male teacher on the same school trip visiting Canada. Other passengers sitting around them, and 49 other students and teachers who were on the school trip are currently being quarantined at a hotel near the airport, under the Quarantine Law.

    The Health, Labor and Welfare Ministry believes that up to 11 passengers slipped into Japan without knowing they were sitting close to the infected student. Even if they were found, the government could not restrict their movements under the law, and healthcare centers would have to keep monitoring them.

    The ministry is rushing to identify those passengers using the airline's passenger list and the contact information they provided on questionnaires, and is asking them to contact its call center at (03) 3501-903

    Comment


    • #3
      Re: Japan confirms 3 swine flu patients

      [ATTACH]3202[/ATTACH]


      ________________________
      sn1987a

      Comment


      • #4
        Re: Japan confirms 3 swine flu patients

        A/Narita/1/2009-05-08(H1N1)


        Code:
        122 >A/Arizona/01/2009/04/22           .A.......... ----------- --------- ............................. ............. .................... ............ ........
        222 >A/Narita/1/2009/05/08             .A.......... .....G..... ...T..... ............................. ............. ....A............... ............ ........
        221 >A/Tennessee/05/2009/04/28         ------------ ----------- ...T..... ............................. ............. ....A............... ------------ ........
         73 >A/Alabama/02/2009/04/27           .A.......... ----------- ...T..... ----------------------------- ------------- -------------------- ------------ ........
        109 >A/Sichuan/1/2009/05/10            .A.......... .G...G..... ......... ..A.......................... ............. .................... ............ ........
        158 >A/South Carolina/09/2009/04/26    .A.A....G... .G...G..... --------- ..A..........G............... .T......A.... .................... ............ ........
        159 >A/England/195/2009/04/28          .A......G... .G...G..... ......... ..A.......................... .T........... .................... ............ ........
        160 >A/Catalonia/148/2009/04//         ------------ ----------- --------- --A..........G............... ------------- -................... ------------ --------
        161 >A/Castilla-LM/GP9/2009/04/26      ------------ ----------- --------- --A..........G...------------ .T........... ------..........---- ............ ........
        162 >A/Valencia/GP4/2009/04/26         ------------ ----------- --------- --A..........G...------------ .........T... ------..........---- ............ ........
        163 >A/Castilla-LM/GP13/2009/04/26     ------------ ----------- --------- --A..........G...------------ .........T... ------..........---- ............ ........
        
        
        
                                               000011112222 00000111112 000000111 00000000000000001111111111111 0000000011111 00000000000111111111 000000000000 00000000 
                                               057923580122 03448017792 556789279 00123356666788880001122233456 0122366801123 02233477779000012333 145667888889 02334777 
                                               749510773628 30572560690 687203348 23497874568137791687968937064 8369946721442 74815144584456853123 892076111273 96465378 
                                               269188720340 60005811052 180060016 27583160897673712803832601834 4278799978383 50364526665492050790 922096567493 42976858 
        -codon-position------------------------  1   2 2 1     2 2  2     1 2  1  11111  11  2  1 1   1 1 1 1      111  12      11 112           1     112 12   1111  12 
        ---Index-------------------------------TGGGAGATAGAG TATCCAGATCG AATCGCAAG CGCTGAGGTCGAATAGGGGGAAGCGACGG TCTGCGCGGCGGA AGAGGTAGAGAACCGTACAT GGGGGCACTCCG TCGAGCAC

        find the connection between the Japanes in Narita and the male,13years from Tennessee
        sampled 28.Apr. ! Give us segments 1 and 2 of the Tennessee boy, please.
        And segments 2,3 of the Arizona boy.

        It has also the Arizona marker (male,8,22.Apr.), that virus has few mutations, suggesting it had
        survived in the environment rather than inside living mammals.

        ---------------------------
        4/29 8:49 pm
        The [first Tennessee] patient is a Williamson County resident, who is receiving treatment for symptoms at home, is recovering from the illness, and has a good prognosis
        Williamson County case that had been sent there for testing late last week. That case was reported to involve a school-age child who was not seriously ill.

        Alabama:female,6years
        The specimens came from students in Heritage Elementary School in Madison, who appear to be recovering
        I'm interested in expert panflu damage estimates
        my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

        Comment


        • #5
          Re: Japan confirms 3 swine flu patients

          just released:

          A/Beijing/01/2009-05-16,F18

          only 6 mutations away from the ****** origin (after ~3.5months !)
          A/Narita/1/2009-05-08 had 7 mutations, 4 of these are shared
          by the Beijing virus.
          So their common origin is only some weeks back.
          (except the virus was hiding in the environment)

          ---------------
          May 18 (Bloomberg) -- China reported its third swine flu infection yesterday in an 18-year-old woman
          who had recently returned from studying in New York.
          The woman, who arrived in Beijing May 11, is currently in stable condition and her body temperature
          is normal, the Ministry of Health said yesterday. All China’s swine flu patients have been students
          returning from studies in North America.
          -----------------------

          this is not a virus which is typically found in New-York.
          And the similarity to the Japanese virus, (Canada-Detroit-Narita) , coincidence ?
          I'm interested in expert panflu damage estimates
          my current links: http://bit.ly/hFI7H ILI-charts: http://bit.ly/CcRgT

          Comment

          Working...
          X