A/Shanghai/71T/2009 acquired E627K

[Mamabird]

The Shanghai virus has acquired an important characteristic that may affect pathogenicity of Swine Flu.

A/Shanghai/71T/2009, sample acquired on May 31, has Lysine at position 627 of the PB2 segment.

Bears watching, but this is definitely not pleasant news.

[gsgs]

I've just been wondering about this virus - but not because of E627K -
it has so many mutation.
Even more Shanghai/37T

[Mamabird]

Originally Posted by gsgs

I've just been wondering about this virus - but not because of E627K -
it has so many mutation.
Even more Shanghai/37T

I know what you mean. Something very strange going on here. I'm attempting to find time to look more closely at all the other gene segments and isolates from the area. So far, everything else looks like a concensus virus, however, PA position 224 has a bad nucleoid (y), and this is an important position in determining which variant.

[wotan]

Previous commentary about this type of change in this virus:

http://www.flutrackers.com/forum/sho...d.php?p=239031

For example, the E627K mutation in the former bird PB2 (substituting a K [lysine] for an E [glutamic acid] at position 627 of PB2) has been put forward as a sign that an avian virus is mutating to one adapted to humans. This virus retains E at 627 but is happily adapted to humans. Several other changes thought to be related to human adaptation are not present, either. The authors conclude the obvious:
Together these data suggest that other previously unrecognized molecular determinants are responsible for the ability of the 2009 A(H1N1) virus to replicate and transmit in humans.

I've done some cursory looking but so far I am not entirely sure what this change might portend. Would this make the virus potentially even more pathogenic? From browsing the site I see some reports that this change does just that in some of the H5N1 isolates. Unfortunately I am still out of my league here. I guess sometime I should buckledown and get a better understanding of genetics in general and flu genetics in particular.

[gsgs]

                                       00000000000000000000000000000000000000000000111111111111111111111111111111111111111222222222222222222222 0000000000000000000000000000000000000000000011111111111111111111111111111111111222222222222 00000000000000000000000000000000000000000000001111111111111111111111111111111111112222222 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111 000000000000000000000000000000000000000000000000000000000000000000111111111111111111111 0000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111 00000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000000000000 
                                       00000000000001112222333344444455556677788899000122223333333334444455555666677777889000000111111111222222 0000000111111111223333444445555666666778899900111112335566666667777789999999999000001112222 00000001111122333345555556666677777888888999990000111112222222333345556667777889990000111 00000011111111122222222333333333444444555555556666666667777777777777888888888888888999999900000000011111111122222222233333444444445555556666666 000000000001111111112222222223333333444445555566666777777888888899000111111112223334444 0000000111111111112222222233333333334444444566666667777777788889999999000000001111222223333334 01111112233333444445566666677788888888899999 00000011222222222333444444444555566666677777777788888888 
                                       00000111134782790248007824577844683714904857146701890135567891133433799368912258774233379000345569124478 0012334455678899290238156781147003689382601758068894891701244990456760012346999033471260026 00345696778905015794556780137902579024889012332246337891113356077835785670467470482479034 01112312334446800114699012345678033459002346773445566880011122557899022333567777799022338900011256824666777911125688923479002356783566781148899 001112466881135778894566677890167899024584567704668025668011457717228112334484672463449 0114679000000235663444889901125568990111256833569992445566814790234558044556893457234581233590 40125680800449233692500678912611124588935667 13578903025677799146003445688234745577722367888911223444 
                                       56789012562286787252399501313167104147980810370308148481367302728504705950512855295802803158323830144940 3598560369202956570171102095981036350295135389915825972140078261380621902672245013068442399 58001662050825684959891983600120277639452933064749189642490664446774563979153288468604595 46892728012576979699158827681631534565578477361037859172567936163158478237170137914014076615624528020148239845836312690918389755316836941747959 890127747464729230664134706281352467267907044649594171673439863928797783143668663984363 5256055012347676898047374835624881368158633807167893266728636346005451047592021256105637902271 52142598009396589422806595673656732923239093 26403423468215901197066496089027291913619895458556239012 
-codon-position------------------------2 12 12     1     2   11    21 1 112  11   12 1    1   1 1  121112 12 21   1     11 211 2122  21   1 2    2112 12   22  1    1    2 2 21    1       12 2   1  2 222  1 1   2 221221   2 2 2    1 1 1 22 1    21  1    1   1    1 11  2 221 2 1 12  11 1 1 1  21  212 21   2 1 211          2   11 111121211 1  2    112      1  121  1   1   111 12     2 2  1 21   2 12 2  1 1       12 2 11 22      12  12  22  1  12  211  1 2 1  1    1  1 2 12  211 2    12  1122     1112   1     11 1 112  21112    21    1 1121    1  1 2    2 2  1  212 122 2  11 1112 1  11 12     11  1  1  12  12 1        2   1 1  2     2     22  1 22     12  11  11 2 12     211   12 1121 11 2  1    121 1 1 112 2 211111 2 12 11121 22111  11122 2  12 12 
---Index-------------------------------AGAGAATAAGCTACAGGAAGGCCAAATGAGGCACGCGAGGCCGATCAGGAACGCCATAACCCAAGACCATCGGGATAATCTGGTAGGCGGAGTCAGGCAAGCCG GACCTTGAGAGCCAGCGCACGGATCCAAACGCGGAATTCCAACAAGCGTAGAGTTGTAAATAAATGTAGAATAATCTCCTAGGCGGGGACA AATGGATCGGATCCGTTGACTCAGATGTTGTCAAGGCGCGGATTCGCGTAAGTGAAGGATATTCTGCGCAGGGCACGCGGTGGTCCTTG AGAGCGGTACACTGGGGTCGCATATACGGGGACTCGAAGTACAACGAGTGTGCCGACATAAGGGCGAGGGAGCATCCGTATGAGCAGCTCGGAGCACGGGCTCGAGTACAGCAAAGCGGGAAGCACCGGAAGGGACCTGAATT CTCAAAGGATTACCTCACAACGACTGAAGGAACTTCTCGGTGAAGGAGTCACAGCTGAAATGTGCTGAGACGTCGAAGAAAGGCGTG ACAATATATTAGATTCTGGGTGAGTTTTGAGCCGCCAGTCCCTTCAGTTGTAAGATGCGCTGCGAGACACAATACCGCGCTTTAGGGCATCACT CAACTGGAGCCGCCCAGCGGAGCAGCCCGCACTTTCCGGGTTTG CCCGGTTGCATCTAGAATGATGCGTGGTAGGGCGGGGGAGGCTAACCAGCCGTGAT 

256 >A/Shanghai/71T/2009/05/31         .................................................................................A...AA..A.A....A....... ...............................................A........................................... ............................Y............................................................ ..................................................A............................................................................................ ............................A............................GT..A............AG.A......... ............................A..............C......................................C..AA....... ..................A..A...................... ...................G................................----       28     28 ,     24     24    256:>A/Shanghai/71T/2009/05/31  
268 >A/NY/20/2009/04/25                ................................................................................................A....... ........................................................................................... ......................................................................................... -----.............................................A......................................T.AG-------------------------------------------------- ............................A.............................................A..A......... ............................A.......................G.......................................-- ..................A..A...................... ...................G....................................       70     70 ,     13     13    268:>A/NY/20/2009/04/25                
274 >A/Shanghai/1/2009/05/23           .........................G........................G.............................................R....... ...............................................A........................................... ...A..................................................................................... ..................................................A................................................................A.......T................... ............................A.............................................A..A......... ............................A.......................G......................................... ..................A..A...................... ................G..G........G..A........A...........----       24     24 ,     20     20    274:>A/Shanghai/1/2009/05/23           
275 >A/Shanghai/37T/2009/05/24         ....................A....G........................G.............................................A....... ...............................................A........................................... ...A..................................................................................... ..................................................A................................................................A.......T................... ............T...............A.............................................A..A......... ............................A...................GTG.G..A.........T............................ ..................A..A......A............... ................G..G....................A...........----       30     30 ,     26     26    275:>A/Shanghai/37T/2009/05/24         



256 >A/Shanghai/71T/2009/05/31         


PB2:.......A...AA..A.A....A....... 


1111111111111222222222222222222222
5666677777889000000111111111222222
9368912258774233379000345569124478
5950512855295802803158323830144940

CGGGATAATCTGGTAGGCGGAGTCAGGCAAGCCG

G1879A,G2032A,G2038A,G2101A,G2108A,G2163A

G1879A must be E627K with amino-acids

[gsgs]

I'm wondering whether they maybe grew it extensively in monkey cells or such.
The numbering 71T looks unusual

[Mamabird]

Originally Posted by gsgs

I'm wondering whether they maybe grew it extensively in monkey cells or such.
The numbering 71T looks unusual

Cannot tell by looking at the GenBank description. But something is very strange about PB2.

Please be aware also that this virus looks in all respects like the variant "iv" types dominated by the New York sequences, however, NA is a mixture that is predominately found in swine viruses. I have not found any human infection isolates with this mix at positions 106 and 247 of NA.

[gsgs]

some other (amino-acid) mutations in the neighborhood.
So, this was a difficult task for the virus ?!

   601 qqmrdvlgtf dtvqiikllp faaappkqsr mqfssltvnv rgsglrilvr gnspvfnynk
                                   E
   661 atkrltvlgk dagaltenpn egtsgvesav lrgflilgke nkkygpalsi nelsnlakge
                         D D                       D R

[Mamabird]

Originally Posted by gsgs

some other (amino-acid) mutations in the neighborhood.
So, this was a difficult task for the virus ?!

   601 qqmrdvlgtf dtvqiikllp faaappkqsr mqfssltvnv rgsglrilvr gnspvfnynk
                                   E
   661 atkrltvlgk dagaltenpn egtsgvesav lrgflilgke nkkygpalsi nelsnlakge
                         D D                       D R

Yes, and the interesting thing is that with respect to this last set of changes shown above, an exact match is with:

A/swine/Hong Kong/NS29/2009

So, we have either had some sort of reassortment/recombination event, or this is simply "lab error". If the former, then "Houston, ugh, we have a problem."

[HenryN]

Originally Posted by wotan

Previous commentary about this type of change in this virus:

http://www.flutrackers.com/forum/sho...d.php?p=239031



I've done some cursory looking but so far I am not entirely sure what this change might portend. Would this make the virus potentially even more pathogenic? From browsing the site I see some reports that this change does just that in some of the H5N1 isolates. Unfortunately I am still out of my league here. I guess sometime I should buckledown and get a better understanding of genetics in general and flu genetics in particular.

This was discussed in May as a "likely" acquisition

Commentary


The rapid spread in the human population increases the likelihood of co-infection with H1N1 seasonal flu and the acquisition of key polymorphisms linked to adaptation in human hosts. Two likely acquisitions are NA H274Y and PB2 E627K, which are fixed in human H1N1.

[gsgs]

maybe I can add the HK sequence later...

                             001122222 1 0 011 00000111 00000000111 000 00000 
                             342800111 1 0 624 12888112 35666779222 467 23457 
                             048733006 6 4 580 19015444 18999453258 902 96842 
                             311928183 1 0 828 78436368 68789270163 203 17979 
-codon-position--------------   11112    1 111  1  1    1 12 11  22      1 1  
Index------------------------GAAGGGGGA G G AGT CAAAGAAA ATTGTGTGTGG AAG AGAGG 
A/Shanghai/71T/2009/05/31    ...AAAAA. A . ..C ..GTA.G. .C...A..CAA ... .....
A/Shanghai/1/2009/05/23      .GG.....R A A .A. ........ ........... ... G.GAA
A/Shanghai/37T/2009/05/24    AGG...... A A .A. T....... ..GTG.AT... ..A G...A
A/******/index/2009-02-01    ........G . . T.C .G...G.G G....A..... GG. .A...
A/******/Cancun/2009-04-15   ......... . . ... ........ ........... ... .....

[sharon sanders]

Doesn't this change make Swine flu more transmissible? It is very transmissible already. Does this make a swine flu infection more lethal?

[Mamabird]

Originally Posted by Florida1

Doesn't this change make Swine flu more transmissible? It is very transmissible already. Does this make a swine flu infection more lethal?

The acquisition of Lysine at 627 of PB2 allows the virus to replicate more readily at cooler temperatures, meaning upper respiratory system, and therefore could make the virus more transmissable. Sneezes and coughs would spread higher viral loads into the air than is likely going at present with the Swine Flu viruses.

Once the virus spreads more readily throughout a population with no immunity to the virus, then one would expect substantially more hospitalizations and deaths, especially for those with underlying health conditions. So, one (transmission) sort of goes with the other (pathogenicity) to some extent for those at risk.

[kent nickell]

It would also seem that with the development of a more mammalian type of replication gene that higher viral loads could develop quicker in individual patients perhaps leading to some of the faster development of disease we are seeing and be more difficult to fight off. Also the shortened incubation time could increase transmission rates...

[HenryN]

Travel log

gb|GQ229297.1| Influenza A virus (A/swine/Hong Kong/NS1659/20... 30.2 45
gb|GQ253501.1| Influenza A virus (A/Shanghai/71T/2009(H1N1)) ... 30.2 45
gb|DQ991325.2| Influenza A virus (A/chicken/Italy/5093/99(H7N... 30.2 45
gb|DQ991309.1| Influenza A virus (A/ostrich/Italy/2332/00(H7N... 30.2 45
gb|DQ991301.1| Influenza A virus (A/ostrich/Italy/2332/00(H7N... 30.2 45
gb|AF258847.1| Influenza A virus (A/Hong Kong/485/97(H5N1)) R... 30.2 45
gb|AF258839.1| Influenza A Virus (A/Hong Kong/483/97(H5N1)) R... 30.2 45
gb|AY342413.1| Influenza A virus (A/Netherlands/219/03(H7N7))... 30.2 45
gb|CY004101.1| Influenza A virus (A/laughing gull/NJ/276/1989... 30.2 45
gb|AF084263.1|AF084263 Influenza A virus (A/HongKong/485/97(H... 30.2 45
gb|AF084262.1|AF084262 Influenza A virus (A/HongKong/483/97(H... 30.2 45
emb|AJ404632.1| Influenza A virus pb2 gene for polymerase Pb2... 30.2 45

[HenryN]

It is worth noting that this travel log includes H1N1 swine from Asia. The last human was the only reported fatal bird flu case that was not H5N1 (the veterinarian from the 2003 H7N7 outbreak in the Netherlands). The travel log also includes the cases from the 1997 H5N1 outbreak in Hong Kong.

[Blue]

Originally Posted by niman

This was discussed in May as a "likely" acquisition

http://www.recombinomics.com/News/05..._Fatality.html


The rapid spread in the human population increases the likelihood of co-infection with H1N1 seasonal flu and the acquisition of key polymorphisms linked to adaptation in human hosts. Two likely acquisitions are NA H274Y and PB2 E627K, which are fixed in human H1N1.

For those who are unaware of what these aquisitions mean, could someone briefly, and simply explain them? I am not good at these explanations.

[HenryN]

Originally Posted by Florida1

Doesn't this change make Swine flu more transmissible? It is very transmissible already. Does this make a swine flu infection more lethal?

This is the winter version (optimal replication at 33C - the temperature of a human nose in the winter).

[Blue]

Sorry about that duplicate post. I have corrected it. You were saying that this allows the virus to be more successful in the winter, I take it?

[gsgs]

didn't we have a 3d-picture of PB2, showing which positions are
close to each other ?
maybe Anne posted it earlier...

but avian-->swine 1998 ??

[sharon sanders]

Originally Posted by Mamabird

The acquisition of Lysine at 627 of PB2 allows the virus to replicate more readily at cooler temperatures, meaning upper respiratory system, and therefore could make the virus more transmissable. Sneezes and coughs would spread higher viral loads into the air than is likely going at present with the Swine Flu viruses.

Once the virus spreads more readily throughout a population with no immunity to the virus, then one would expect substantially more hospitalizations and deaths, especially for those with underlying health conditions. So, one (transmission) sort of goes with the other (pathogenicity) to some extent for those at risk.

Thank you!

[thebes]

This is another of Dr. Niman's commentaries which is relevant:

http://www.recombinomics.com/News/05..._Seasonal.html

This movement of swine H1N1 into the human population is cause for concern. The increase over seasonal flu may be driven by the avian PB2 gene in the swine isolate. Position 627 is E, which favors growth at the higher body temperature of birds. Seasonal flu has a K at position 627, which allows for more rapid replication at a lower temperature, which is consistent with the internal temperature of a human nose in the winter.

The presence of avian PB2 may offer a selective advantage over the summer, when seasonal flu falls to barely detectable levels. However, the swine H1N1 that moves south in the upcoming months will be growing under colder conditions, which may favor the acquisition of E627K though reassortment or recombination. This change could create a more virulent H1N1 in the fall in the northern hemisphere.

Thus, the swine H1N1 may be launching a two virus strategy. The H1N1 with avian PB2 will dominate in the northern hemisphere over the summer, while the H1N1 in the southern hemisphere will acquire E627K and establish dominance during the winter months.

[Blue]

Thanks Mamabird and Thebes!

Your posts were very helpful.

[Blue]

Oops! Let me not forget to thank you also, Dr. Niman!

[Mamabird]

Originally Posted by Mamabird

Please be aware also that this virus looks in all respects like the variant "iv" types dominated by the New York sequences, however, NA is a mixture that is predominately found in swine viruses. I have not found any human infection isolates with this mix at positions 106 and 247 of NA.

I have located a number of Swine Flu sequences that have the unique combination in NA of V106I and D247N like that of A/Shanghai/71T and the swine isolates. Interestingly, they are are all, without exception, from Japan. We probably should keep a wary eye out for E627K in the Japan PB2 for all future sequences posted.

[wotan]

What would be more favourable for invasion of the lungs? I can see how the avian component would be more beneficial there (presumably the lungs have a higher temperature. But better replication in the upper repiratory tract could also allow for more chances for the virus to invade the middle and lower respiratory tracts.

[gsgs]

the virus is the Cancun-strain, but it misses 2 of the 11 Cancun markers (C1408T(4),A742G(6)),
the same as Korea/1 and the Japan viruses.
However those have not the other 6 Cancun markers which 71T has.

That could indicate reassortment ?!? 123578 from Cancun,
46 from Japan/Korea

[sharon sanders]

Originally Posted by kent nickell

It would also seem that with the development of a more mammalian type of replication gene that higher viral loads could develop quicker in individual patients perhaps leading to some of the faster development of disease we are seeing and be more difficult to fight off. Also the shortened incubation time could increase transmission rates...

Thanks for all the great explanations for lay persons. Also Kent too!

[Mamabird]

Originally Posted by wotan

What would be more favourable for invasion of the lungs? I can see how the avian component would be more beneficial there (presumably the lungs have a higher temperature. But better replication in the upper repiratory tract could also allow for more chances for the virus to invade the middle and lower respiratory tracts.

Once the Swine Flu virus has invaded and infected its human host, it seems to have little problem in replicating in both the lungs and the nose where the alpha 2,6 receptors are readily found. And remember, most of the isolates collected from humans are nasal swabs.

However, with the E627K change, the viral loads in the nose will likely be even higher than they are currently. So the virus will still replicate in both the lungs and nose, but with higher viral loads in the nose, the coughs and sneezes will spread more of the pathogen into the air for all of us to breath.

If you think that the current Swine Flu spreads rapidly, hide and watch what happens when E627K becomes predominant. No country has adequate medical facilities to handle the influz of patients that will unsue.

[Nancy]

In case any one else out there is asking themselves, "what's Shanghai virus?" as I was, here is an OLD (1990) NY Times article about it. If it is irrelevant, feel free to delete.

I don't understand why, if Shanghai virus was a significant problem in the winter of 1989-1990, it wouldn't ALREADY have acquired the ability to spread easily during cold weather?? But you're saying this is new? And is Shanghai currently widespread? More than other strains of seasonal influenza? I'm confused.

Here's the article I found:
http://www.nytimes.com/1990/01/26/us...-epidemic.html

U.S. Health Agency Declares Flu EpidemicBy WILLIAM K. STEVENS
Published: Friday, January 26, 1990

Centers for Disease Control declared yesterday [January 25, 1990] that a nationwide influenza epidemic exists and that it is the most widespread outbreak of the disease since 1984-85.

The flu, predominantly a strain called A-Shanghai, has been identified in every part of the country, and major outbreaks have been found in 35 states, epidemiologists at the centers say.

''We're in an epidemic,'' said Dr. Walter Gunn, a specialist in viral diseases at the centers, in Atlanta.

Based on Death Reports

The epidemic was declared on the basis of reports of deaths from 121 cities around the country. The proportion of deaths caused by influenza and pneumonia, a complication of the flu, was higher than expected for the second consecutive week, meeting the center's definition of an epidemic.

Because there is a lag between the onset of the flu and death and because it takes a week or so to report the deaths, the figures actually reflect the incidence of flu in late December and early January, said Dr. Stephen Ostroff, another epidemiologist at the centers in Atlanta.

Ordinarily, he said, the peak of the flu season comes in the middle to the end of February. This year, he said, ''the surge has come earlier, and we don't know whether it's going to subside early.''

Immunization Still Effective

Dr. Gunn urged flu immunization for people older than 65, those of any age who are in ill health ''and anyone who doesn't want to get the flu.''

Symptoms include a sudden onset of fever, chills, sore throat, headache, muscle aches and pains, general malaise and a dry cough. Dr. Gunn said simple gastrointestinal upset, which seems to have afflicted many in the New York region recently, is probably caused by viruses or infections other than the flu unless the stomach distress is accompanied by other flu symptoms.

When the flu kills people, epidemiologists say, it usually does so through pneumonia, which develops as a secondary infection. But it can also cause death through kidney failure and heart attacks, Dr. Gunn said.

Britain Hit by Same Strain

Dr. Gunn said A-Shanghai flu has been associated with more deaths and more instances of severe complications than other strains.

The A-Shanghai virus has also been responsible for Britain's worst flu epidemic in 14 years. Much of Europe, including the Soviet Union, has also been affected. In Britain last month, the epidemic put so many people in the hospital that London hospitals had to cancel thousands of routine operations and accept only emergency admissions.

In an average year in the United State, Dr. Gunn said, the flu plays a role in at least 20,000 deaths. ''This year we think it's going to be worse,'' he added. ''We don't know how much worse.''

In the outbreak in the winter of 1984-85, 57,400 deaths were attributed to the flu or pneumonia.

Linked to 7.6 Percent of Deaths

Last week, 1,132, or 7.6 percent, of the 15,090 deaths reported to the disease control centers from the 121 cities were attributed to flu or pneumonia. The percentage a week earlier was identical. Usually, the figure is between 6 percent and 6.5 percent for those two weeks, Dr. Ostroff said. Not since the 1984-85 season has that usual level been exceeded by as much as it was in the last two weeks.

The centers said that last week 18 states experienced flu outbreaks considered widespread, with outbreaks in counties accounting for more than half the state's population. Seventeen other states experienced regional outbreaks, with outbreaks in counties accounting for less than half the state population.

The epidemic did not begin in any specific part of the country, Dr. Gunn said. Rather, he said, ''it has been all over the place right from the beginning and has kept enlarging.''

The states reporting widespread outbreaks last week were Connecticut, New York, Massachusetts, Michigan, Wisconsin, Minnesota, Missouri, South Dakota, Nebraska, Virginia, North Carolina, Georgia, Mississippi, Oklahoma, Texas, Montana, Idaho and Arizona.

Those states reporting regional outbreaks were New Hampshire, Pennsylvania, Ohio, Iowa, Delaware, West Virginia, Kentucky, Tennessee, Alabama, Arkansas, Louisiana, Wyoming, Utah, Nevada, Alaska, Washington and New Mexico.

Two other varieties of flu, A-Taiwan and Influenza B, have also been detected in limited outbreaks, the first in Alaska, Arizona, Massachusetts and Iowa, and the second in Virginia and Nebraska, Dr. Gunn said. The symptoms are similar to those of A-Shanghai.

Map of the United States showing the influenza outbreaks by state (NYT)