UK Genetic Evaluation thread

NS1 · #1 December 22nd, 2010, 07:47 AM

edited to add:

Please see corresponding news thread:

UK: Reports of Approximately 57 Deaths and 800+ Patients in intensive care (50 deaths confirmed by HPA as for Jan. 06 2011) due to influenza

Perhaps one of the contributing sparks in the

UK

has been located.

Two adjacent bird flu polymorphisms are emerging on the pandemic H1N1 NA segment primarily within 2010 human sequences that carry the HA 188T. This two change combination is found in PF11 on 17 Neuraminidase sequences, but more than 200 times in Avian H3N8, Avian H1N1 and every Avian HxN1 serotype from H2N1 to H12N1. The UKWhiteChapel4880374_2M_2010_11_28 carries these two adjacent NA changes.

HA 188T is highly correlated with NA syn240T & 241I combination.

HA

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 0A,
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L ctTgtagtctccctgggg)

NA

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 79P,
. . . . . . . . 100H mix wt,
. . . . . . . . syn109G,
. . . . . . . . syn240T,
. . . . . . . . 241I,
. . . . . . . . 369K,
. . . . . . . . syn377P)

Notes:
syn240T with 241I
BLAST string=ggttcttgctttaccata,
GISAID exam=212 matches
pH1N1 2010 Human ~ 16
pH1N1 2009 Human ~ 1
Remainder are Avian Influenza:
H3N8 mallard/Ohio/184/1986
Avian H1N1, H2N1, H3N1, H4N1, H5N1, H6N1, H7N1, H9N1, H10N1, H11N1, H12N1

NS1 · #2 December 22nd, 2010, 06:04 PM

Quote:

Originally Posted by ironorehopper

Although travel-log of the above mentioned gene polymorphisms is very useful to track evolution and to understand influenza viruses ecology and the development of distinct lineages, the actual impact on field epidemiology remains to be established.

In other words, we have to wait at least for two or three week, when the epidemic peak should be reached and a first, retrospective analysis of transmissibility and intrinsic virulence of H1N1 (2009) strains are circulating in UK and elsewhere will be more clear.

Human immune system can fight influenza probably even with immune memory and not only through the main humoral response, elicited by vaccines.

Common-sense hygiene measures, such as handwashing, cough etiquette, and avoid crowded places, as well as remaining at home when ill or feverish represent also very useful instrument to reduce or slow the speed of propagation of the virus into community.

Hindsight is practically more accurate than foresight. We all may agree on that fact.

Once an event has passed, the deeper measurements that were taken during the event may be closely evaluated. Given that consideration, proposals should be in hand now across the UK. Field epidemiology, in this present matter, may be justified in increasing assets to the present cases so that these questions may be answered very soon . . . prior to a more distinct or more severe wave.

In most cases of genetic variation, the clinical variation may only be known by closely tracking, correlating and culling the data points. In the UK today, severe disease is a fact, at a higher concentration than has been seen (another fact), whilst the overall case count remains low. Those general cumulative statistics guide us to a more detailed investigation which must occur at the individual case level. In order for those investigations of the actionable data to occur, the importance data points must be captured at the time of the event.

When the count of ICU beds for ILI has risen from 100 to 302 over less than two weeks, clearly additional and improved surveillance is indicated.

Ergo, very few genetic changes may be conclusively deemed as creating a generalised "severe" outcome.

On the other hand, if the data is not gathered at the time of the event, neither the scientists, nor the public will ever discern the potential connections. Blind is blind, but closing one's eyes at the critical time immediately prior to any crisis is an intentional decision. Those types of decisions are predictable as to outcome: preparation time and quality is reduced.

Let's continue to closely investigate and postulate each iota of information available, while encouraging more robust systems and deeper participation.

The NA polymorphisms discussed here are highly correlated to the HA 188T that has recently begun spreading (rare yet) across the world. If that HA 188T is under inspection, perhaps we all should increase focus to this associated NA pair of changes at aa240 and aa241.

This NA question is raised alongside the more distinct potential of a significant change in the RBS range from 225 to 230.

What we do know is that present and historical data perfectly demonstrate that very slight changes in genetics, as few as one genetic change, may create much higher levels of severity.

Is this change one of those types of variations? No risk at all exists in evaluating the potential. Significant risk is created when emerging data is tabled for "future study" during a crisis.

NS1 · #3 December 22nd, 2010, 06:32 PM

Quote:

Originally Posted by ironorehopper

Although travel-log of the above mentioned gene polymorphisms is very useful to track evolution and to understand influenza viruses ecology and the development of distinct lineages, the actual impact on field epidemiology remains to be established.

In other words, we have to wait at least for two or three week, when the epidemic peak should be reached and a first, retrospective analysis of transmissibility and intrinsic virulence of H1N1 (2009) strains are circulating in UK and elsewhere will be more clear.

Human immune system can fight influenza probably even with immune memory and not only through the main humoral response, elicited by vaccines.

Common-sense hygiene measures, such as handwashing, cough etiquette, and avoid crowded places, as well as remaining at home when ill or feverish represent also very useful instrument to reduce or slow the speed of propagation of the virus into community.

Working with the current sparse data allows very few comprehensive and exacting responses; however, based on simple frequency analysis, a very slight potential also exists in the UK for HA changes upstream and adjacent to aa225, at residues 223 or 224.

At this juncture, "Low Reactors" are recorded with 224 amino acid variation on backgrounds with additional changes, but the single change has not been evaluated alone on a pH1N1 background for Vaccine Escape as far as we've seen. Validation on this matter would be appreciated.

223E was only recently documented in the PF11 reservoir from the early pandemic last year from the Southern Hemisphere in Brisbane. As the White Chapel sequence, UKWhiteChapel4880374_2M_2010_11_28, taken from the 2 year old boy prior to the severe UK wave is closely related to an August 2010 Brisbane sequence as discussed, we all must be on watch for changes beyond the most likely aa225.

Will the severity in the UK be caused by a single change or a complex of variation?

No one will know until properly managed sequences are available in quantity with clinical metadata.

NS1 · #4 December 23rd, 2010, 05:04 AM

The HPA released a set of 4 UK sequences at GISAID on 2010-12-20 from the pre-severity phase dating from 2010-08-07 to 2010-11-28. We provide our ongoing and quite skeletal notes from the focal analysis for the sake of timeliness in collaboration. Additional interpretation will be pursued at the weekend and updated here at FT.

No imagination is required to see that 225G and / or 156E may be eventually, if not currently, attracted to the UKWhiteChapel4880374_2M_2010_11_28 background due to extensive homology shared with the previously discussed OzBrisbane209_51F_2010_08_09.

HA

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 0A [Arizona05_2010_05_01
. . . . . . . . . . . . . . . with syn338G & 377K,
. . . . . . . . . . Alabama08_2009_12_04
. . . . . . . . . . . . . . . with syn226Q, 310A mix & 506V,
. . . . . . . . . . RussiaPerm_ZTS_2009_11_30
. . . . . . . . . . . . . . . with 377K & syn475D,
. . . . . . . . . . RussiaBelgorod01_2009_11_30,
. . . . . . . . . . RussiaBelgorod05_2009_11_30,
. . . . . . . . . . Boston634_2009_11_09
. . . . . . . . . . . . . . . with 100N & syn270I],
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L)

NA Score# 2601 ~
Johannesburg/115/2010 Score# 2584
India/8910/2010
Ghana/FS-10-4259/2010 Score# 2579
Ghana/FS-10-4241/2010
Johannesburg/119/2010
India/5107/2010
Florida/14/2010 Score# 2575
Kenya/0025/2009 Score# 2573

NA

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 79P,
. . . . . . . . 100H mix wt,
. . . . . . . . syn109G,
. . . . . . . . syn240T,
. . . . . . . . 241I,
. . . . . . . . 369K,
. . . . . . . . syn377P)

NA syn240T with 241I
Avian H1N1, H2N1, H3N1, H4N1, H5N1, H6N1, H7N1, H9N1, H10N1, H11N1, H12N1
17 human H1N1 2010

HA

. . . . UKCambridge118_4F_2010_11_19 (
. . . . . . . . syn118E,
. . . . . . . . 137T [41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L,
. . . . . . . . syn293L,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q,
. . . . . . . . syn474C,
. . . . . . . . 504G,
. . . . . . . . 513V)

HA

. . . . UKWhiteChapel4780352_5M_2010_10_26 (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S,
. . . . . . . . syn210S,
. . . . . . . . 377K)

NA Score# 2604 ~
Hawaii/13/2010 Score# 2577
California/VRDL129/2009
Malaysia/15506/2009
WAIKATO/118/2009
Washington/58/2009
ferret/Washington/WADDL13230/2009 Score# 2571
Boston/617/2009 Score# 2571

HA

. . . . UKBirmingham3220137_44F_2010_08_07 (
. . . . . . . . #8A,
. . . . . . . . 175K,
. . . . . . . . 311E,
. . . . . . . . 377K,
. . . . . . . . syn385V,
. . . . . . . . syn451K,
. . . . . . . . syn454S,
. . . . . . . . syn494E,
. . . . . . . . 537G)

NA Score# 2604 ~
NY3263_2009 Score# 2593
ferret/Washington/WADDL13230/2009 Score# 2588

NS1 · #5 December 24th, 2010, 01:58 AM

Are we cross-validating the fact that Brisbane, a potential donor into the UK severe wave, and all of Queensland are, at this moment, experiencing a 700% increase in case count for 2010 influenza over the December 2009 cases?

Is it possible that the colder weather in the UK is creating aberrant host-pathogen behaviour or inducing genetic variation in-vivo that creates a more severe outcome though the overall case count remains low in the UK? Would the warmer weather of the Southern Hemisphere perhaps allow a higher transmissibility with less severe outcomes from the same initial infectious dosage of the same viral particles?

Apparently, we may have been presented with the ideal experimental model to determine the effect of atmospheric measures against clinical outcomes and genetic acquisition (speed and quality) if we find that the UK and Australia are concurrently suffering under the same viral genetics reservoir.

The release of sequences with clinical metadata from the UK fatalities alongside sequences from December in Australia would prove useful in these evaluations.

NS1 · #6 December 27th, 2010, 10:27 AM

The latest sequences soon to be on file at GenBank demonstrate ongoing transmission of pandemic H1N1 influenza carrying HA 188T. The Tehran University of Medical Sciences has made available A/Karaj/5327/2010(H1N1), sampled on 2010-12-06.

The National Institute for Infectious Disease in Japan introduced 13 sequences at GISAID today. One from October 2010 appears to be an intermediate form in this emerging background with 188T, though the sequence is truncated at a critical point.

Notice as we've mentioned in previous posts that the most recent IranKaraj sequence seems to have become more refined through simplification, perhaps culling the unnecessary changes (duplicate function / human species maladaption?) from JapanKanagawa74 (122I, 143R & 186P) while maintaining the useful foundation (syn34N, 146G, 188T & 200T) and extending recombination such as the syn465N found in Brisbane in August 2010, missing in the UK, then reapplied onto the IranKaraj sequence.

In similar fashion to IranKaraj at syn538F, recall that 3 of 4 sequences from the latest UK deposit carry polymorphisms in the HA gene segment downstream of aa499, including 504G, 513V, syn529L and 537G.

The PF11 viral reservoir appears to be introducing diversity with new genetic material at the head and the foot of the HA gene segment. Many of the recent related sequences to the UK backgrounds (at individual point variations) happen to carry polymorphisms in this post-aa499 area of the HA gene segment, including OzVictoria670_2010_11_14 (syn512R), OzSydney217_2010_09_19 (523A), Stockholm5_2010_08_27 (525G), GhanaFS10_4259_2010_08_27 (syn537S), GhanaFS10_4241_2010_08_25 (syn537S), Florida13_2010_08_02 (512M), OzVictoria800_2010_07_02 (502K, syn529L [CTa]), India3725_2010_04_03 (syn526S), Ukraine123_2010_02_14_xL (syn500R), Netherlands2629_2009_12_04 (507E), RussiaPermCREI_ZTS_2009_11_30 (syn542S), Brunei218_2010 (syn538F) & BrasilBahia15525_42M_2009_09_05 (syn499N mix wt, 511I mix wt).

. . . . IranKaraj5327_2010_12_06 (
. . . . . . . . syn34N [JapanKanagawa74_2010_10_16, et al],
. . . . . . . . 146G [JapanKanagawa74_2010_10_16, et al],
. . . . . . . . 188T,
. . . . . . . . 200T,
. . . . . . . . syn338G,
. . . . . . . . 377K,
. . . . . . . . 454N,
. . . . . . . . syn465N [OzBrisbane209_51F_2010_08_09,
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . CalifVRDL131_2009_12_30, et al],
. . . . . . . . syn538F [Brunei218_2010 with 188T])

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches,
. . . . . . . . . . . . . . et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])

. . . . JapanKanagawa74_2010_10_16 (
. . . . . . . . syn34N,
. . . . . . . . 122I,
. . . . . . . . 143R,
. . . . . . . . 146G,
. . . . . . . . 186P mix wt,
. . . . . . . . 188T,
. . . . . . . . 200T,
. . . . . . . . HA truncated after aa330)

Supporting Sequences

. . . . OzBrisbane209_51F_2010_08_09 (
. . . . . . . . 156E [H2N3, H3N8, H5N1, H10N7],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . 225G,
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzVictoria670_30M_2010_11_14
. . . . . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . . . . . . Emergent across Australia
. . . . . . . . . . . . . . . . . . . . . during late 2010 season,
. . . . . . . . . . . . . . . Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . . . . . . OZVictoria512_2010_07_30
. . . . . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . . . . . . NZChristchurch15_2010_07_12
. . . . . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . . . . . . India5107_2010_06_28
. . . . . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . . . . . . MississippiAF2474_2010_03_10
. . . . . . . . . . . . . . . . . . . . . with syn235T,
. . . . . . . . . . . . . . . FloridaAF2197_2010_03_07
. . . . . . . . . . . . . . . . . . . . . with 156T,
. . . . . . . . . . . . . . . CalifVRDL9_2010_02_09
. . . . . . . . . . . . . . . . . . . . . with syn193S,
. . . . . . . . . . . . . . . Georgia06_2010_02_05
. . . . . . . . . . . . . . . . . . . . . with syn161Y,
. . . . . . . . . . . . . . . NY4662_2010_02_03
. . . . . . . . . . . . . . . . . . . . . with 97N, syn276H, syn283Q, syn304G,
. . . . . . . . . . . . . . . TexasJMS406_2010_01_10
. . . . . . . . . . . . . . . . . . . . . with 187A, syn193S, syn283Q,
. . . . . . . . . . . . . . . TexasJMS405_2010_01_09
. . . . . . . . . . . . . . . . . . . . . with 187A, syn283Q,
. . . . . . . . . . . . . . . CalifVRDL131_2009_12_30
. . . . . . . . . . . . . . . . . . . . . with 225G, syn455Q,
. . . . . . . . . . . . . . . LouisianaAF2435_2009_11_30
. . . . . . . . . . . . . . . . . . . . . with syn13N,
. . . . . . . . . . . . . . . Vienna291_2009_11_19
. . . . . . . . . . . . . . . catOregon29573_2009_11_09
. . . . . . . . . . . . . . . . . . . . . with 226R, syn283Q,
. . . . . . . . . . . . . . . Calif_SanDiegoINS63_2009_10_26
. . . . . . . . . . . . . . . . . . . . . with syn283Q, et al],
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K,
. . . . . . . . . . Texas45131774_2009_09_13
. . . . . . . . . . . . . . . . . . with syn223V,
. . . . . . . . . . IndiaPune9355_2009_08
. . . . . . . . . . . . . . . . . . with 225G,
. . . . . . . . . . IndiaBlore236_2009_06_xL
. . . . . . . . . . . . . . . . . . with 226R, et al],
. . . . . . . . syn465N)

NS1 · #7 December 27th, 2010, 11:00 AM

Neuraminidase homology exists between IranKaraj and the UKWhiteChapel4880374_2M_2010_11_28 at aa240, 241, 369 and 377.

The UK NA bears a combination of successfully human-adapted H1N1 polymorphisms that have not been found together with the H3N8-matched 79P polymorphism.

NA

. . . . IranKaraj5327_2010_12_06 (
. . . . . . . . 44S,
. . . . . . . . syn45Q,
. . . . . . . . syn126P,
. . . . . . . . syn240T [UKWhiteChapel4880374_2M_2010_11_28],
. . . . . . . . 241I [UKWhiteChapel4880374_2M_2010_11_28],
. . . . . . . . syn366S,
. . . . . . . . 369K [UKWhiteChapel4880374_2M_2010_11_28],
. . . . . . . . syn377P [UKWhiteChapel4880374_2M_2010_11_28])

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 79P [SNP H3N8 (cAA), H7N7 (cTG), H9 Vx (cAt)],
. . . . . . . . . . . [PF11 12 Instances, None with syn240T or 241I],
. . . . . . . . 100H mix wt [S8, S7, WSN33 with syn240T & 241I],
. . . . . . . . . . . . . . . . . . [Avian H5N1, H11N1],
. . . . . . . . syn109G [S7],
. . . . . . . . syn240T (ACc) [S7, tn],
. . . . . . . . 241I (aTA) [1918, S7],
. . . . . . . . 369K [swIndiana17311_2010_03_17]
. . . . . . . . . . . . . [S9, S8, S7],
. . . . . . . . syn377P (CCa) [WSN33 (CCt), S7 (CCt)])

NS1 · #8 December 28th, 2010, 05:53 AM

The Tohoku University Graduate School of Medicine in Sendai, Japan released a sequence dated only as 2009 (MDCK passage) that carries the 188T featuring on the sub-clade building recently in the UKWhiteChapel4880374_2M_2010_11_28 sequence.

. . . . JapanSendaiTU617_2009 (
. . . . . . . . syn16T,
. . . . . . . . syn84E,
. . . . . . . . 174R,
. . . . . . . . syn177L (CTt),
. . . . . . . . 188T,
. . . . . . . . 200T)

The Sendai sequence is complete and demonstrates none of the trailing polymorphisms of the emergent strains found across Australia, England and Iran. Additional date specificity and host meta-data would clarify the positioning of this sequence in the genetic acquisition train.

HA 188T rapidly emerged geographically throughout 2010 and is now found in 26 pH1N1 Human and 1 pH1N1 swine sequences across Africa, Asia, India, Oceania, the UK, Brunei, Iran and the United States.

NS1 · #9 December 29th, 2010, 01:09 AM

Collaboration requires data sharing, sometimes when the data is uncomfortably rough or even inexplicable. But that's the purpose of collaboration, right?

We collaborate to discover something that we did not already know. We collaborate when world health is in question.

UK_December_Emerging_Genetics_v0.xls

This GeneWurx Version Zero Excel spreadsheet represents an effort to externalise to the public our current rough lab notes on the 4 published UK HA gene segments and worldwide HA sequences that we've ascertained may be related. UK titles and UK polymorphisms are color-coded green wherever they are found.

Each column represents a sequence of interest. The rows are filled with change data ordered by the amino acid position. This presentation of detailed data obviously required some careful editing for brevity. Even so, the reviewer will be inclined to scroll and / or hide columns in order to fully review relationships.

The materials demonstrate the flow of genetic data from the Southern Hemisphere 2010 into the Northern Hemisphere today. For example, investigate the various similarities from columns AQ to AZ. The UKWhiteChapel4880374_2M_2010_11_28 sequence in column AX is our primary interest due to patterning suggestive of a capability to carry 156E / 158E and / or 225G.

The authors are grateful to GenBank and GISAID for making their depository of valuable genetic material accessible and to those from many countries who have shared their sequences for the sake of public health. We also are thankful to a certain physicist who initiated the concept and layout for public presentation of this detailed genetics data.

As always, any errors are those of the authoring team. Please provide errata via private message as you discover required corrections.

NS1 · #10 December 29th, 2010, 08:14 PM

** Caveat **

Due to data scarcity, apparently sanctioned by officials, this evaluation is forced to extrapolate from media reports.

The factor used to fill the gap is defined clearly as to source and the calculations are presented via a reusable Excel spreadsheet.

** End Caveat **

Total case count officially increased by 44.9% in the UK, but ICU beds with Influenza (London) appear to have potentially risen by up to 90%.

Notice also that official releases early today failed to provide a new count on total or district Influenza ICU cases.

The December 23rd official report (latest) showed that 1 of 7 ICU beds (~13%) were Influenza cases. Compare that figure to the 2009 pH1N1 Pandemic peak of roughly less than 1 of 12. The Health Emergency campaign group today claimed that London hospitals are reporting that up to 25% of ICU beds are Influenza cases.

For the purposes of least optimal projections, recasting the factors countrywide is a reasonable evaluation due to the fact that London appeared to be trailing in cases and severity until this report. Based on the 25% number and 3500 beds nationwide, a practical doubling is indicated of the Influenza cases percentage of ICU / ITU over 5 to 6 days and brings the total cases at this time to potentially ~875 people in Intensive Care at one time for Influenza, a 90% increase in 5 to 6 days.

GeneWurx_UK_ICU_Categories_v0.xls

Again these factors are recast from London across the entire nation due to lack of data reporting and, as such, the results may be heavily skewed in either direction. Understanding the assumptions behind the calculation allows a guidepoint to be reached. If the results prove solid, then the case count rose by ~45% while the ICU percentage, at least in one major city (London), may have increased by 90% or more.

These extrapolations suggest a severe wave that is continuing.

GeneWurx and the concerned public would be more than pleased to have these calculations invalidated by actual official reports of current information from the public health officials, alongside genetic sequences tagged according to mild, severe and fatal cases with clinical progression meta-data.

NS1 · #11 December 29th, 2010, 10:29 PM

Shiloh has opened a thread discussing the fact that an epidemic threshold has been reached officially in the UK for the age range of 1 to 4 years old, the very young children.

http://www.flutrackers.com/forum/sho...d.php?t=157361

The epidemic threshold is also being approached for the entire under 5 year old group, but has not been reached due to the low count in the under 1 year old category. The obvious question of whether these low results in the baby age bracket are accurate or due to failure to diagnose is not satisfied at this time.

NS1 · #12 December 30th, 2010, 06:22 AM

An inspection of the final syn529L polymorphism on the White Chapel sequence from the 2 year old boy, noted here and previously, demonstrates a change unique to pH1N1 even at this late stage.

Though 2 different additional versions (CCa, tTG) of this silent polymorphism at aa529 have been found in the reservoir in rare quantities, the change at the third base of the codon (CCt) for the White Chapel sequence appears to have propagated from an entirely separate origin, a human-adapted seasonal H1N1 strain circulating in 2007. With a total of 37 HA syn529L instances in human Pandemic H1N1 2009 on record for the earlier CCa and tTG codings, this novel change (CCt) may demonstrate new behaviour for this virus.

Consider that human-adapted changes from seasonal H1N1 2007 also share extensive homology with the NA for this White Chapel sequence.

Frequent change has been noted on emergent 2010 pH1N1 strains after amino acid position 500 and in some cases has been associated with fatality (502K and syn542S). In a domain briming with recent diversity, these 38 changes of three variant silent codings at a single position, aa529, offer a block of data that may interest keen investigators.

GeneWurx has prepared a rough estimation for public review in an Excel spreadsheet detailing the findings as of December 25, 2010 for syn529L as related to the current emerging epidemic in England, Wales and Scotland.

GeneWurx_UKWhiteChapel_Unique_syn529L_Variation_v0 .xls

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches,
. . . . . . . . . . . . . . et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])

NS1 · #13 December 30th, 2010, 06:47 AM

Neuraminidase (NA) Review

UKWhiteChapel4880374_2M_2010_11_28

Six of the seven polymorphisms on the Neuraminidase (NA) for UKWhiteChapel4880374_2M_2010_11_28 have now been confirmed with matches to various seasonal human H1N1 (S9, S8, S7). The seventh change, a T->C (T235C) SNP, coding for 79P, is found extensively in the zoonotic reservoirs across multiple species.

This first base donor for the UK PF11 NA 79P codon (cCA) occurs at least 19 times in H3N8 from 2009 to 2005, spanning a wide range of mammal species:

Horses
Dogs
Swine

Geographic significance is found in Sydney, Australia where the SNP is found in the following 2007 H3N8 animal sequences.

H3N8 canineSydney6692_2007_10_15
H3N8 canineSydney6525_2007_10_14
H3N8 equineSydney6085_2007_10_10

This fact becomes of higher interest when we inspect the similarity of the dates and sample identification numbers. The possibility exists that these 3 animals were in a transmission chain on a ranch that may have included undetected or unsequenced human infection.

Note that the HA of UKWhiteChapel4880374_2M_2010_11_28 is most closely matched to an Australian sequence. The three H3N8 sequences from Sydney also carry the HA syn474C found in a separate sub-clade within the 4 UK sequences on UKCambridge118_4F_2010_11_19. Evidently, pH1N1 is moving toward homology with non-human mammal H3N8 on the HA AND the NA gene segments in two separate genetic backgrounds within the UK.

Sub-segment genetic recombinations from H3N8 onto human backgrounds are considered of interest in relation to severity.

Furthermore, the SNP coding for the NA 79P is also demonstrated in two other zoonotic Influenza serotypes. In 2009, the change appears in Eastern Europe on an Avian H7N7 sample, mallardPolandM446_2009. Recall that the UKWhiteChapel4880374_2M_2010_11_28 HA 188T may have also originated from H7N7. Furthering the animal connection, the NA 79P SNP appears on a domestic poultry, lab-derived vaccine strain on the H9 background.

This NA 79P from the animal reservoirs may have accumulated onto a very human-adapted NA in Australia / UK, generating a novel gene segment with a combination previously unknown in humans.

. . . . UKWhiteChapel4880374_2M_2010_11_28 (
. . . . . . . . 79P [SNP H3N8 (cAA), H7N7 (cTG), H9 Vx (cAt)],
. . . . . . . . . . . [PF11 12 Instances, None with syn240T or 241I],
. . . . . . . . 100H mix wt [S8, S7, WSN33 with syn240T & 241I],
. . . . . . . . . . . . . . . . . . [Avian H5N1, H11N1],
. . . . . . . . syn109G [S7],
. . . . . . . . syn240T (ACc) [S7, tn],
. . . . . . . . 241I (aTA) [1918, S7],
. . . . . . . . 369K [swIndiana17311_2010_03_17]
. . . . . . . . . . . . . [S9, S8, S7],
. . . . . . . . syn377P (CCa) [WSN33 (CCt), S7 (CCt)])

NS1 · #14 December 30th, 2010, 05:01 PM

** Please note that the figure of 738 ICU Influenza patients has been defined by RoRo as being only for England. Figures for Wales, Scotland and Ireland will be produced as they are available. **

Total case count officially increased by 44.9% in the UK, but ICU beds with Influenza (HPA Week 52) appear to have risen at the substantially higher rate of 60%.

The December 23rd official report (latest) showed that 1 of 7 ICU beds (~13%) were Influenza cases. Compare that figure to the 2009 pH1N1 Pandemic peak of roughly less than 1 of 12. The 738 ICU cases reported today demonstrate that UK hospitals are utilising 1 of 5 ICU beds for Severe Influenza cases.

GeneWurx_UK_ICU_Categories_v1.xls

These extrapolations suggest a severe wave that is continuing.

GeneWurx and the concerned public would like like to thank the officials who released the data today. Additional information is, however, required, including more frequent updates on cases, ICU cases and fatalities, alongside genetic sequences tagged according to mild, severe and fatal cases with clinical progression meta-data.

NS1 · #15 December 31st, 2010, 05:11 AM

We may find this set of sequences to be instructive to the UK severe wave in the days to come when NIMR releases sequences.

HA 230I Cross-Linked in Slovakia on Broad Background

Last Updated 2010-12-31

The UK National Institute for Medical Research published a group of sequences on 2010-12-30 at GISAID. One group originated from the National Public Health Institute of Slovakia.

An unusual and persistent background pivoting around 8 polymorphisms on 5 sequences arose during March 2010 in Slovakia pairing two silent polymorphisms for the first time (syn23L and syn177L (CTt)). The Slovakian sequences are all cross-linked with the HA syn413K and the NA syn407V.

Of particular interest is the Slovakia1625_56X_2010_03_30_xL from a 56 year old of unspecified gender due to the 9th polymorphism, a very rare HA 230I. As of this deposit, the multiple backgrounds that are permissive to the HA 230I change extends to a new platform that appears to transmit (5 geographically similar sequences in 5 days).

GeneWurx has prepared an Excel spreadsheet investigating potential genetic acquisition in the currently uncharted severe Pandemic H1N1 wave in the UK. In Version 1 of this spreadsheet, the Slovakian 230I sequence takes Column U and provides homology to one UK White Chapel sequence of interest.

GeneWurx_UK_December_Emerging_Genetics_v1.xls

. . . . Slovakia1625_56X_2010_03_30_xL (
. . . . . . . . syn23L,
. . . . . . . . 100N,
. . . . . . . . syn177L (CTt),
. . . . . . . . syn216E,
. . . . . . . . 230I (ATa),
. . . . . . . . 324I,
. . . . . . . . syn400F,
. . . . . . . . syn413K,
. . . . . . . . 461E [UKEngland712_2009_09 with 24K])

. . . . Slovakia1623_39X_2010_03_30_xL (
. . . . . . . . syn23L,
. . . . . . . . 100N,
. . . . . . . . syn177L (CTt),
. . . . . . . . syn216E,
. . . . . . . . 324I,
. . . . . . . . syn400F,
. . . . . . . . syn413K,
. . . . . . . . 452I,
. . . . . . . . 461E [UKEngland712_2009_09 with 24K])

. . . . Slovakia1624_61X_2010_03_30_xL (
. . . . . . . . syn23L,
. . . . . . . . 100N,
. . . . . . . . syn177L (CTt),
. . . . . . . . syn216E,
. . . . . . . . 324I,
. . . . . . . . syn400F,
. . . . . . . . syn413K,
. . . . . . . . 461E [UKEngland712_2009_09 with 24K])

. . . . Slovakia1626_59X_2010_03_30_xL (
. . . . . . . . syn23L,
. . . . . . . . 100N,
. . . . . . . . syn177L (CTt),
. . . . . . . . syn216E,
. . . . . . . . 324I,
. . . . . . . . syn400F,
. . . . . . . . syn413K,
. . . . . . . . 461E [UKEngland712_2009_09 with 24K])

. . . . Slovakia1634_42X_2010_04_03_xL (
. . . . . . . . syn23L,
. . . . . . . . 100N,
. . . . . . . . syn177L (CTt),
. . . . . . . . syn216E,
. . . . . . . . 324I,
. . . . . . . . syn400F,
. . . . . . . . syn413K,
. . . . . . . . 461E [UKEngland712_2009_09 with 24K])
Supporting Sequences

. . . . UKEngland712_2009_09 (
. . . . . . . . 24K,
. . . . . . . . syn413K,
. . . . . . . . syn456L,
. . . . . . . . 461E [Slovakia1625_56X_2010_03_30_xL with 230I])

. . . . DenmarkHvidovreINS141_2009_11_20_xL (
. . . . . . . . syn23L,
. . . . . . . . syn238E,
. . . . . . . . 324I,
. . . . . . . . syn413K,
. . . . . . . . syn484N,
. . . . . . . . syn549R)

. . . . Victoria508_2010_07_24 (
. . . . . . . . 35I [H5N1],
. . . . . . . . 88P [H2N3, H5N1, H11],
. . . . . . . . . . . [HunanHechengSWL1616_2009-11-23,
. . . . . . . . . . . KoreaAF2376_2009_10_27
. . . . . . . . . . . . . . . with 280A and 290K],
. . . . . . . . syn102E [SingON2407_2009_12_13,
. . . . . . . . . . . . . . . Singapore544_2009_12_10,
. . . . . . . . . . . . . . . Brussels243_2009_11_09
. . . . . . . . . . . . . . . . . . . . with syn44L and 89G],
. . . . . . . . syn152I [CalifVRDL115_2009_12_04,
. . . . . . . . . . . . . . . NY6939_2009_12_11,
. . . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 35I, syn219I, syn276H, syn456L, 463V, 523A,
. . . . . . . . . . . . . . . England1050_2009_12,
. . . . . . . . . . . . . . . Scotland103_2009_12,
. . . . . . . . . . . . . . . England1051_2009_12,
. . . . . . . . . . . . . . . ItalyAncona451_2009_11_27_f,
. . . . . . . . . . . . . . . NY6607_2009_11_24,
. . . . . . . . . . . . . . . CalifVRDL107_2009_11_15,
. . . . . . . . . . . . . . . CalifVRDL101_2009_11_05,
. . . . . . . . . . . . . . . DC_114_2009_11_04,
. . . . . . . . . . . . . . . England94800096_2009_11,
. . . . . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . . . . NY5447_2009_10_23,
. . . . . . . . . . . . . . . CalifVRDL84_2009_10_09,
. . . . . . . . . . . . . . . CalifVRDL87_2009_10_09,
. . . . . . . . . . . . . . . IndiaPune6196_2009_08,
. . . . . . . . . . . . . . . IndiaDhule9433_2009_08,
. . . . . . . . . . . . . . . SantoDomingoWR1057N_2009_07_02,
. . . . . . . . . . . . . . . SantoDomingoWR1058N_2009_07_02,
. . . . . . . . . . . . . . . SantoDomingoWR1059N_2009_06_30],
. . . . . . . . 206S,
. . . . . . . . syn219I [CalifVRDL115_2009_12_04
. . . . . . . . . . . . . . . . . with 35I, syn152I, syn276H, syn456L, 463V, 523A,
. . . . . . . . . . . . . . FL_Pen213_2009_11_17
. . . . . . . . . . . . . . . . . . . . with 35I, syn152I, 273A, syn456L, 463V, 523A,
. . . . . . . . . . . . . . CalifVRDL107_2009_11_15
. . . . . . . . . . . . . . . . . . . . with 35I, syn152I, syn276H, syn456L, 463V, 523A,
. . . . . . . . 238D (GAc) [H2N3, H7N3, H7N7],
. . . . . . . . . . . . . . . . . . [Belgorod2_2010-03-15 (GAt),
. . . . . . . . . . . . . . . . . . Kaliningrad01_2009_11_02 (GAt)
. . . . . . . . . . . . . . . . . . . . . . . . with 225E and 226R,
. . . . . . . . . . . . . . . . . . AthensINS398_2010-01-24 GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_DA_2009-09-26 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_KG_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_MA_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_SHD_2009-09-25 (GAt),

. . . . . . . . . . . . . . . . . . KaliningradCRIE_ZD_2009-09-25 (GAt)],
. . . . . . . . syn247A [Belize8756_2009_10_08,
. . . . . . . . . . . . . . . Singapore93_2009_06_22]
. . . . . . . . syn254P,
. . . . . . . . 272G [Niigata19_2009_12_31,
. . . . . . . . . . . . GuangdongSWL36_2009_11_29],
. . . . . . . . syn276H,
. . . . . . . . syn388K [H5N1],
. . . . . . . . . . . . . . . [NagasakiHA_10_28_2010_03_23
. . . . . . . . . . . . . . . . . . . . . with 22I,
. . . . . . . . . . . . . . . NagasakiHA_10_26_2010_03_15
. . . . . . . . . . . . . . . . . . . . . with 22I, syn103E,
. . . . . . . . . . . . . . . NagasakiHA_10_24_2010_03_08
. . . . . . . . . . . . . . . . . . . . . with syn103E,
. . . . . . . . . . . . . . . GuangxiLonganSWL1990_2010_02_08
. . . . . . . . . . . . . . . . . . . . . with 453K, syn462E,
. . . . . . . . . . . . . . . JiangxiDonghuSWL15_2010_01_04
. . . . . . . . . . . . . . . . . . . . . with syn106E, 149R, syn456L (TTg),
. . . . . . . . . . . . . . . ViennaINS142_2009_11_26
. . . . . . . . . . . . . . . . . . . . . with syn97D, 99T,
. . . . . . . . . . . . . . . CzechUsti208_2009_11_25
. . . . . . . . . . . . . . . . . . . . . with 268T,
. . . . . . . . . . . . . . . GhanaFS_1921_2009_11_11,
. . . . . . . . . . . . . . . Alaska44_2009_11_17
. . . . . . . . . . . . . . . . . . . . . with syn275V, 276N,
. . . . . . . . . . . . . . . CalifVRDL76_2009_09_21
. . . . . . . . . . . . . . . . . . . . . with syn283Q,
. . . . . . . . . . . . . . . Taiwan206_2009_09_18,
. . . . . . . . . . . . . . . Taiwan177_2009_09_18,
. . . . . . . . . . . . . . . Taiwan167_2009_09_18,
. . . . . . . . . . . . . . . Taiwan156_2009_09_18,
. . . . . . . . . . . . . . . Taiwan143_2009_09_15
. . . . . . . . . . . . . . . . . . . . . with 205E mix,
. . . . . . . . . . . . . . . Utah20_C2_2_2009_07_25_VxX
. . . . . . . . . . . . . . . . . . . . . with 159D, 206S, 227G
. . . . . . . . . . . . . . . Slovenia2687_2009_07_01
. . . . . . . . . . . . . . . . . . . . . with 35I, 206S],
. . . . . . . . syn456L,
. . . . . . . . 463V,
. . . . . . . . 523A [Nebraska02_2010_03_11,
. . . . . . . . . . . . NagasakiHA1022_2010_03_01_syn413K,
. . . . . . . . . . . . DomRepublic3768_2009_12_15,
. . . . . . . . . . . . NY6939_2009_12_11,
. . . . . . . . . . . . CalifVRDL115_2009_12_04,
. . . . . . . . . . . . NY6607_2009_11_24,
. . . . . . . . . . . . RheinlandPfalz81_2009_11_23,
. . . . . . . . . . . . Berlin210_2009_11_16,
. . . . . . . . . . . . BadenWurttemberg511_2009_11_16,
. . . . . . . . . . . . CalifVRDL107_2009_11_15,
. . . . . . . . . . . . FL_Pensacola40_2009_11_09,
. . . . . . . . . . . . CalifVRDL101_2009_11_05,
. . . . . . . . . . . . DC114_2009_11_04,
. . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . NY5447_2009_10_23,
. . . . . . . . . . . . CalifVRDL84_2009_10_09,
. . . . . . . . . . . . CalifVRDL87_2009_10_09,
. . . . . . . . . . . . KuwaitN13013_2009_08_31_syn413K]),

NS1 · #16 December 31st, 2010, 05:29 PM

UK Rise in Neuraminidase Inhibitor Anti-Viral Drug Resistance

The UK HPA Weekly National Influenza Reports covering the emerging epidemic from the past two weeks (Week 51 and Week 52) provide insight into data scarcity surrounding anti-viral drug resistance.

Oseltamivir-resistance may be determined genetically from a Single Nucleotide Polymorphism (SNP) H275Y on the Neuraminidase. Clinical anti-viral resistance and / or ineffectiveness in Pandemic H1N1 Influenza continues to manifest much more widely than can be attributed to the genetic variance of NA 275Y. In the future, other factors may be identified as genetically leading to the clinical manifestations in cases that do not demonstrate H275Y, but for the moment, the measurement is at that single change.

The HPA Week 51 data reported 3 TmX cases from 402 tested (~0.75%).
The HPA Week 52 data reported 5 TmX cases from 336 tested (~1.49%).

As you can see, the percentage of resistant cases week over week increased by 99%. Unfortunately, data sparsity alongside the fact of taking percentages of percentages may not allow this figure to be fully reliable for decision-making.

On the other hand, in a crisis when faced with limited testing capacity and limited testing foundation, these are the types of acceleration / deceleration calculations that must be made. Data that is available is used. GeneWurx would like to see clinical meta-data paired with genetic sequences to assist in pinpointing various HA polymorphisms that may also be associated with drug resistance, such as those trailing HA aa500.

GeneWurx has prepared an Excel spreadsheet so that the public may track any ongoing official and / or unofficial data concerning Anti-Viral resistance patterns.

GeneWurx_UK_2010_2011_Severe_Wave_TmX_v0.xls

Bear in mind that a recent seasonal influenza rapidly progressed from Anti-Viral sensitivity to Anti-Viral resistance across the world in less than one full season when the percentage of strains demonstrating NA H275Y reached approximately 2%.

More than 100 drug-resistant human Pandemic H1N1 sequences are on file considering just North America and Asia. Washington01_2010_04_02_TmX from the United States registered with 33 polymorphisms across the HA and NA gene segments. In August 2010, GeneWurx evaluated 7 sequences from Japan with extensive HA diversity and H275Y TamiFlu Resistance.

With drug resistant, hypermorphic strains carrying shared HA polymorphisms now being documented across a wide geography, will the resistant 2% begin to spread in Winter 2010-2011?

NS1 · #17 January 1st, 2011, 02:31 AM

HA 158E in Cameroon Pair with Additional HA Changes Correlated to Anti-Viral Resistance

The UK National Institute for Medical Research published a group of sequences on 2010-12-30 at GISAID. One group originated from the Centre Pasteur du Cameroun.

HA 158E, a polymorphism associated with Vaccine Escape, appears in two Cameroon sequences upon a highly plastic background that is demonstrated worldwide, including multiple non-adjacent, coastal areas of the United States and in Australia on a background that may be permissive to HA 230I.

This Cameroon background has additionally been conserved in domestic poultry Pandemic H1N1 from Canada.

The most recent sequence taken in April 2010, Cameroon10v_1090_2010_04_08, also carries HA syn223V just upstream of the 225 amino acid position that is so often tracked. HA syn223V has been co-located with 454N in Texas45131774_2009_09_13. 454N and other changes at 454 are highly correlated to the most recent UK sequences on file and to a chain of sequences spanning Australia before the UK and Iran after the UKWhiteChapel4880374_2M_2010_11_28 sample. The related hypermorphic Australian sequence, OzVictoria508_9F_2010_07_24, shares 8 changes with Cameroon.

Notice that the syn254P is has been found on a Japanese TamiFlu Resistant sequence. 523A, which is found at various points on Vaccine Escape and TamiFlu Resistant sequences, is also contained within the potential UK donation reservoir from Australia.

Based on these updates from NIMR, potential exists for a 158E emergence in the UK.

GeneWurx has prepared an Excel spreadsheet investigating potential genetic acquisition in the currently uncharted severe Pandemic H1N1 wave in the UK. In Version 2 of this spreadsheet, the Cameroon 158E sequence takes Column W and provides homology with potential predecessors to one UK White Chapel sequence of interest.

GeneWurx_UK_December_Emerging_Genetics_v2.xls

. . . . Cameroon10v_1090_2010_04_08 (
. . . . . . . . 35I,
. . . . . . . . 114L,
. . . . . . . . syn152I,
. . . . . . . . 158E,
. . . . . . . . syn219I,
. . . . . . . . syn223V [Thailand34_9913_2010_07_14,
. . . . . . . . . . . . . . Texas45131774_2009_09_13],
. . . . . . . . syn254P [Kumamoto2_2010_01_14_TmX],
. . . . . . . . syn276H,
. . . . . . . . syn402H,
. . . . . . . . syn419L,
. . . . . . . . syn456L,
. . . . . . . . 463V,
. . . . . . . . 523A [OzSydney217_2010_09_19 with 188T,
. . . . . . . . . . . . . OzVictoria508_9F_2010_07_24,
. . . . . . . . . . . . . Montana02_2010_04_07_VxX,
. . . . . . . . . . . . . Shizuoka_C21_2010_01_20_TmX])

. . . . Cameroon10v_813_2010_03_23 (
. . . . . . . . 35I,
. . . . . . . . syn152I,
. . . . . . . . 158E mix wt,
. . . . . . . . syn219I,
. . . . . . . . syn254P,
. . . . . . . . syn276H,
. . . . . . . . HA truncated after aa396)

Supporting Sequences

. . . . OzVictoria508_9F_2010_07_24 (
. . . . . . . . 35I [H5N1],
. . . . . . . . 88P [H2N3, H5N1, H11],
. . . . . . . . . . . [HunanHechengSWL1616_2009-11-23,
. . . . . . . . . . . KoreaAF2376_2009_10_27
. . . . . . . . . . . . . . . with 280A and 290K
. . . . . . . . . . . Nevada15_9F_2009_09_10
. . . . . . . . . . . . . . . with 22I, 225E, 256F, 299Y,
. . . . . . . . . . . . . . . . . . 299Y, 300S, syn384S,
. . . . . . . . . . . GermanyCologne13_2009_06_29
. . . . . . . . . . . . . . . with 35I, 38V, syn108L,
. . . . . . . . . . . . . . . . . . syn205G, 206s, syn276H],
. . . . . . . . syn102E [SingON2407_2009_12_13,
. . . . . . . . . . . . . . . Singapore544_2009_12_10,
. . . . . . . . . . . . . . . Brussels243_2009_11_09
. . . . . . . . . . . . . . . . . . . . with syn44L and 89G],
. . . . . . . . syn152I [CalifVRDL115_2009_12_04,
. . . . . . . . . . . . . . . NY6939_2009_12_11,
. . . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 35I, syn219I, syn276H,
. . . . . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . . . . . . . . England1050_2009_12,
. . . . . . . . . . . . . . . Scotland103_2009_12,
. . . . . . . . . . . . . . . England1051_2009_12,
. . . . . . . . . . . . . . . ItalyAncona451_2009_11_27_f,
. . . . . . . . . . . . . . . NY6607_2009_11_24,
. . . . . . . . . . . . . . . CalifVRDL107_2009_11_15,
. . . . . . . . . . . . . . . CalifVRDL101_2009_11_05,
. . . . . . . . . . . . . . . DC_114_2009_11_04,
. . . . . . . . . . . . . . . England94800096_2009_11,
. . . . . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . . . . NY5447_2009_10_23,
. . . . . . . . . . . . . . . CalifVRDL84_2009_10_09,
. . . . . . . . . . . . . . . CalifVRDL87_2009_10_09,
. . . . . . . . . . . . . . . IndiaPune6196_2009_08,
. . . . . . . . . . . . . . . IndiaDhule9433_2009_08,
. . . . . . . . . . . . . . . SantoDomingoWR1057N_2009_07_02,
. . . . . . . . . . . . . . . SantoDomingoWR1058N_2009_07_02,
. . . . . . . . . . . . . . . SantoDomingoWR1059N_2009_06_30],
. . . . . . . . 206S,
. . . . . . . . syn219I [CalifVRDL115_2009_12_04
. . . . . . . . . . . . . . . . . with 35I, syn152I, syn276H,
. . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . . . . . . . FL_Pen213_2009_11_17
. . . . . . . . . . . . . . . . . . . . with 35I, syn152I, 273A,
. . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . . . . . . . CalifVRDL107_2009_11_15
. . . . . . . . . . . . . . . . . . . . with 35I, syn152I, syn276H,
. . . . . . . . . . . . . . . . . . . . syn456L, 463V, 523A,
. . . . . . . . 238D (GAc) [H2N3, H7N3, H7N7],
. . . . . . . . . . . . . . . . . . [Belgorod2_2010-03-15 (GAt),
. . . . . . . . . . . . . . . . . . Kaliningrad01_2009_11_02 (GAt)
. . . . . . . . . . . . . . . . . . . . . . . . with 225E and 226R,
. . . . . . . . . . . . . . . . . . AthensINS398_2010-01-24 GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_DA_2009-09-26 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_KG_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_MA_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_SHD_2009-09-25 (GAt),
. . . . . . . . . . . . . . . . . . KaliningradCRIE_ZD_2009-09-25 (GAt)],
. . . . . . . . syn247A [Belize8756_2009_10_08,
. . . . . . . . . . . . . . . Singapore93_2009_06_22]
. . . . . . . . syn254P,
. . . . . . . . 272G [Niigata19_2009_12_31,
. . . . . . . . . . . . GuangdongSWL36_2009_11_29],
. . . . . . . . syn276H [1918, S5],
. . . . . . . . syn388K [H5N1],
. . . . . . . . . . . . . . . [NagasakiHA_10_28_2010_03_23
. . . . . . . . . . . . . . . . . . . . . with 22I,
. . . . . . . . . . . . . . . NagasakiHA_10_26_2010_03_15
. . . . . . . . . . . . . . . . . . . . . with 22I, syn103E,
. . . . . . . . . . . . . . . NagasakiHA_10_24_2010_03_08
. . . . . . . . . . . . . . . . . . . . . with syn103E,
. . . . . . . . . . . . . . . GuangxiLonganSWL1990_2010_02_08
. . . . . . . . . . . . . . . . . . . . . with 453K, syn462E,
. . . . . . . . . . . . . . . JiangxiDonghuSWL15_2010_01_04
. . . . . . . . . . . . . . . . . . . . . with syn106E, 149R, syn456L (TTg),
. . . . . . . . . . . . . . . ViennaINS142_2009_11_26
. . . . . . . . . . . . . . . . . . . . . with syn97D, 99T,
. . . . . . . . . . . . . . . CzechUsti208_2009_11_25
. . . . . . . . . . . . . . . . . . . . . with 268T,
. . . . . . . . . . . . . . . GhanaFS_1921_2009_11_11,
. . . . . . . . . . . . . . . Alaska44_2009_11_17
. . . . . . . . . . . . . . . . . . . . . with syn275V, 276N,
. . . . . . . . . . . . . . . CalifVRDL76_2009_09_21
. . . . . . . . . . . . . . . . . . . . . with syn283Q,
. . . . . . . . . . . . . . . Taiwan206_2009_09_18,
. . . . . . . . . . . . . . . Taiwan177_2009_09_18,
. . . . . . . . . . . . . . . Taiwan167_2009_09_18,
. . . . . . . . . . . . . . . Taiwan156_2009_09_18,
. . . . . . . . . . . . . . . Taiwan143_2009_09_15
. . . . . . . . . . . . . . . . . . . . . with 205E mix,
. . . . . . . . . . . . . . . Utah20_C2_2_2009_07_25_VxX
. . . . . . . . . . . . . . . . . . . . . with 159D, 206S, 227G
. . . . . . . . . . . . . . . Slovenia2687_2009_07_01
. . . . . . . . . . . . . . . . . . . . . with 35I, 206S],
. . . . . . . . syn456L [H5N1],
. . . . . . . . 463V,
. . . . . . . . 523A [Nebraska02_2010_03_11,
. . . . . . . . . . . . NagasakiHA1022_2010_03_01_syn413K,
. . . . . . . . . . . . DomRepublic3768_2009_12_15,
. . . . . . . . . . . . NY6939_2009_12_11,
. . . . . . . . . . . . CalifVRDL115_2009_12_04,
. . . . . . . . . . . . NY6607_2009_11_24,
. . . . . . . . . . . . RheinlandPfalz81_2009_11_23,
. . . . . . . . . . . . Berlin210_2009_11_16,
. . . . . . . . . . . . BadenWurttemberg511_2009_11_16,
. . . . . . . . . . . . CalifVRDL107_2009_11_15,
. . . . . . . . . . . . FL_Pensacola40_2009_11_09,
. . . . . . . . . . . . CalifVRDL101_2009_11_05,
. . . . . . . . . . . . DC114_2009_11_04,
. . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . NY5447_2009_10_23,
. . . . . . . . . . . . CalifVRDL84_2009_10_09,
. . . . . . . . . . . . CalifVRDL87_2009_10_09,
. . . . . . . . . . . . KuwaitN13013_2009_08_31_syn413K])

. . . . CalifVRDL115_2009_12_04 (
. . . . . . . . . . . . 35I [H5N1],
. . . . . . . . . . . . 77N,
. . . . . . . . . . . . syn152I,
. . . . . . . . . . . . syn219I,
. . . . . . . . . . . . syn276H [1918, S5],
. . . . . . . . . . . . syn456L [H5N1],
. . . . . . . . . . . . 463V,
. . . . . . . . . . . . 523A)

. . . . FL_Pen213_2009_11_17 (
. . . . . . . . . . . . 35I [H5N1],
. . . . . . . . . . . . syn152I,
. . . . . . . . . . . . syn219I,
. . . . . . . . . . . . 273A,
. . . . . . . . . . . . syn276H [1918, S5],
. . . . . . . . . . . . syn456L [H5N1],
. . . . . . . . . . . . 463V,
. . . . . . . . . . . . 523A)

. . . . CalifVRDL107_2009_11_15 (
. . . . . . . . . . . . 35I [H5N1],
. . . . . . . . . . . . 39N,
. . . . . . . . . . . . syn152I,
. . . . . . . . . . . . syn219I,
. . . . . . . . . . . . syn276H [1918, S5],
. . . . . . . . . . . . syn456L [H5N1],
. . . . . . . . . . . . 463V,
. . . . . . . . . . . . 523A)

. . . . KoreaAF2376_2009_10_27 (
. . . . . . . . 88P [H2N3, H5N1, H11],
. . . . . . . . . . . . [Victoria508_2010_07_24 with ext changes,
. . . . . . . . . . . HunanHechengSWL1616_2009-11-23,
. . . . . . . . . . . Nevada15_9F_2009_09_10,
. . . . . . . . . . . GermanyCologne13_2009_06_29],
. . . . . . . . 131P,
. . . . . . . . 280A,
. . . . . . . . 290K [HunanHechengSWL1617_2009_11_23],
. . . . . . . . HA truncated after aa386)

. . . . Nevada15_9F_2009_09_10 (
. . . . . . . . 22I,
. . . . . . . . 88P,
. . . . . . . . 225E,
. . . . . . . . 256F,
. . . . . . . . 299Y,
. . . . . . . . 300S,
. . . . . . . . syn384S)

. . . . GermanyCologne13_2009_06_29 (
. . . . . . . . HA truncated until aa28,
. . . . . . . . 35I,
. . . . . . . . 38V,
. . . . . . . . 88P,
. . . . . . . . syn108L,
. . . . . . . . syn205G,
. . . . . . . . 206S,
. . . . . . . . syn276H,
. . . . . . . . HA truncated after aa321)

. . . . Texas45131774_2009_09_13 (
. . . . . . . . syn223V [H5N1, H6N1],
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . . . . . [IndiaPune9355_2009_08 with 225G,
. . . . . . . . . . . . . . IndiaBlore236_2009_06 with 226R,
. . . . . . . . . . . . . . SouthCarolina18_2009_09_16_VxX,
. . . . . . . . . . . . . . FL_Pen210_2009_11_10 with 225E]),

. . . . Shizuoka_C21_2010_01_20_TmX (
. . . . . . . . 22I,
. . . . . . . . syn149K,
. . . . . . . . syn413K,
. . . . . . . . 523A [Extensive US 2010 April & May (10),
. . . . . . . . . . . . on entirely different background,
. . . . . . . . . . . . including Montana02_2010_04_07_VxX]),

. . . . Kumamoto2_2010_01_14_TmX (
. . . . . . . . syn10Y [China22811_2009_12
. . . . . . . . . . . . . . . . . . . with 14 HA changes],
. . . . . . . . 252L [Maryland03_2010_01_13,
. . . . . . . . . . . . Guangdong2361_2009_11_25],
. . . . . . . . syn254P [1918, tn, H5N1]),
. . . . . . . . . . . . . . [Ancona451_2009_11_27_f,
. . . . . . . . . . . . . . Iran15583_2009_11_21
. . . . . . . . . . . . . . . . . . with 16 HA (226R) + 3 NA changes,
. . . . . . . . . . . . . . Iran16677_2009_11_24],
. . . . . . . . syn320G [H5N1],
. . . . . . . . . . . . . . [Yamagata307_2009_09_24
. . . . . . . . . . . . . . . . . . . with 123T, syn134G,
. . . . . . . . . . . . . . Moscow_ION_2009_07_16,
. . . . . . . . . . . . . . Bolivia1263_2009_07_14 with syn107Q,
. . . . . . . . . . . . . . Mie41_2009_07_11 with syn107Q]
. . . . . . . . syn366A (GCa) [H5N1],
. . . . . . . . . . . . . . [Unique to PF11 Asia,
. . . . . . . . . . . . . . Netherlands2143_2009_11_16,
. . . . . . . . . . . . . . Maryland31_2009_11_09,
. . . . . . . . . . . . . . Calif_SD35_2009_10_26,
. . . . . . . . . . . . . . NY5297_2009_10_22,
. . . . . . . . . . . . . . NorthCarolina53_2009_10_18,
. . . . . . . . . . . . . . Stockholm67_2009_07_17,
. . . . . . . . . . . . . . MauritusMPn_2009_07_01,
. . . . . . . . . . . . . . MauritusMPt_2009_07_01,
. . . . . . . . . . . . . . ENG92860032_2009_07,
. . . . . . . . . . . . . . ENG520_2009_06,
. . . . . . . . . . . . . . ENG507_2009_06,
. . . . . . . . . . . . . . WiscS1416_2009_10_26_xL (GCt),
. . . . . . . . . . . . . . TexasJMS385_2009_12_04 (GCt)],
. . . . . . . . syn390N [H2, H3N8, H5, H6, H7N3, H7N7, H9N2, H11],
. . . . . . . . . . . . . . [Calif09_2010_05_11,
. . . . . . . . . . . . . . NY7480_2010_03_01,
. . . . . . . . . . . . . . NY03_2010_02_09,
. . . . . . . . . . . . . . Texas01_2010_01_13,
. . . . . . . . . . . . . . TexasJMS400_2009_12_31,
. . . . . . . . . . . . . . TexasJMS399_2009_12_31,
. . . . . . . . . . . . . . TexasJMS398_2009_12_30,
. . . . . . . . . . . . . . TexasJMS397_2009_12_30,
. . . . . . . . . . . . . . Washington73_2009_12_14,
. . . . . . . . . . . . . . NY6937_2009_12_11,
. . . . . . . . . . . . . . Bishkek03_2009_11_28
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . Tomsk06_2009_11_22,
. . . . . . . . . . . . . . Russia200_2009_11_01
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . NY5196_2009_10_20,
. . . . . . . . . . . . . . NY5141_2009_10_16
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . ENG94280034_2009_10_06,
. . . . . . . . . . . . . . Texas45093846_2009,
. . . . . . . . . . . . . . Texas45024243_2009,
. . . . . . . . . . . . . . AfghanistanN10786_2009_09_07
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN10760_2009_09
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN09787_2009_08
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . Nepal (Nov)
. . . . . . . . . . . . . . NeimengguHuimin11560_2009_12_30,
. . . . . . . . . . . . . . Kentucky16_2009_07_30],
. . . . . . . . syn466G [H5N1, tn],
. . . . . . . . . . . . . . [Unique to PF11 Japan,
. . . . . . . . . . . . . . ChongqingYuzhong11307_2009_12_15
. . . . . . . . . . . . . .. . . . . . . . . . with 219V,
. . . . . . . . . . . . . . NY6864_2009_12_02
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . NY6909_2009_11_29
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . GuangdongHaizhu1644_2009_11_25,
. . . . . . . . . . . . . . NY6675_2009_11_24
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . DC46_2009_11_03
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . NY4995_2009_10_04
. . . . . . . . . . . . . .. . . . . . . . . . with 530I,
. . . . . . . . . . . . . . CalifVRDL75_2009_09_19
. . . . . . . . . . . . . .. . . . . . . . . . with 119M,
. . . . . . . . . . . . . . Texas45130742_2009_09_13,
. . . . . . . . . . . . . .. . . . . . . . . . with syn227E,
. . . . . . . . . . . . . . Texas45132788_2009_09_13,
. . . . . . . . . . . . . . Texas45120922_2009_09_12,
. . . . . . . . . . . . . . Texas45122282_2009_09_12,
. . . . . . . . . . . . . . Texas45113882_2009_09_11],
. . . . . . . . syn548C [H5N1, 1918, tn]
. . . . . . . . . . . . . . [Unique to PF11 Asia,
. . . . . . . . . . . . . . Bishkek03_2009_11_28
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . Russia200_2009_11_01
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S, 175D,
. . . . . . . . . . . . . . NY5141_2009_10_16
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN10786_2009_09_07
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN10760_2009_09
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S,
. . . . . . . . . . . . . . AfghanistanN09787_2009_08
. . . . . . . . . . . . . .. . . . . . . . . . with syn131S])

NS1 · #18 January 1st, 2011, 08:25 AM

UK Homology on Cameroon Pair Carrying 230I Permissive SNPs

The UK National Institute for Medical Research published a group of sequences on 2010-12-30 at GISAID. One group originated from the Centre Pasteur du Cameroun.

Two young boys, ages 10 and 7, are part of a transmission chain extended over 13 days. Cameroon10v_00812_7M_2010_03_23 is an exact HA match with Cameroon10v_00751_10M_2010_03_10.

These two sequences carry genetics common to the most recent October and November 2010 UK sequences while combining polymorphisms associated with RBD changes including 230I. Using domaining produces a clear relationship between Cameroon and the 230I carrier and 230I permissive sequences. Simple scrolling of the provided spreadsheet demonstrates the relationships.

GeneWurx has prepared an Excel spreadsheet investigating potential genetic acquisition in the currently uncharted severe Pandemic H1N1 wave in the UK. In Version 3 of this spreadsheet, this Cameroon representative sequence, Cameroon10v_00812_7M_2010_03_23, takes Column U and provides homology with UK sequences of recent interest.

GeneWurx_UK_December_Emerging_Genetics_v3.xls

. . . . Cameroon10v_00812_7M_2010_03_23 (
. . . . . . . . 100N [UKWhiteChapel4780352_2010_10_26
. . . . . . . . . . . . . . . . with 128D, syn131S, syn210S, 377K],
. . . . . . . . syn137A [UKCambridge118_2010_11_19
. . . . . . . . . . . . . . . . . . . . with syn363G, syn455Q, syn474C,
. . . . . . . . . . . . . . . . NorthCarolina56_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 100N, 377K],
. . . . . . . . 218V [Minnesota04_18M_2010_03_22
. . . . . . . . . . . . . . . . with 165N, 230I, syn346G,
. . . . . . . . . . . . . Pennsylvania14_20M_2009_06_07
. . . . . . . . . . . . . . . . with 158E, 523I],
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G [IranShiraz1_2010_02
. . . . . . . . . . . . . . . . . . . . with 218A, 228R,
. . . . . . . . . . . . . . . . swThaiCURA4_2009_11
. . . . . . . . . . . . . . . . . . . . with 226R, syn484N],
. . . . . . . . 377K,
. . . . . . . . 457R [swJapanOkinawa2_2005
. . . . . . . . . . . . . . . . with 225G],
. . . . . . . . syn461K [Iran16273_2009_11_22
. . . . . . . . . . . . . . . . . . . . with syn55L, 226R],
. . . . . . . . syn466G [cheetahCA30954_2009_11_17
. . . . . . . . . . . . . . . . . . . . with syn169I, 200S])

. . . . Cameroon10v_00751_10M_2010_03_10 (
. . . . . . . . 100N,
. . . . . . . . syn137A,
. . . . . . . . 218V,
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G,
. . . . . . . . 377K,
. . . . . . . . 457R,
. . . . . . . . syn461K,
. . . . . . . . syn466G)

NS1 · #19 January 2nd, 2011, 06:26 AM

Cameroon 230I Permissive Sequences Carry H3N8 and H7N7 Zoonotic Matches

Recently published sequences from Cameroon show homology to backgrounds that have supported HA 230I. Several of these backgrounds carry homology to animal reservoirs and Cameroon follows suit. These two young boys, ages 10 and 7, who were part of a transmission chain extended over 13 days may or may not have had close contact with animals. Cameroon10v_00812_7M_2010_03_23 is an exact HA match with Cameroon10v_00751_10M_2010_03_10.

The sequences are potentially related to the severe wave in the UK that has filled hospitals and, more importantly, Intensive Care Units to capacity (edit S.S.). English elective surgeries are actively being cancelled. Families are being told not to attempt a hospital visit in the case of Influenza due to the infrastructure strain. Emergency departments are forced to place patients on gurneys due to no beds being available while operating theatres and lounges are being hastily converted to patient rooms. These and other escalation procedures are reported in the media to be underway in hospitals throughout the country with several institutions presently indicating "Red" or "Black" alert levels.

Animal influences on the genetics of human-infecting Influenza like the pH1N1 strain may generate extreme outcomes and variant clinical behaviour. In these cases from Cameroon, the syn350G, 457R, syn461K and syn466G, among others, share homology with animal reservoirs as noted on the sequence details. We have discussed widely the HA 188T found in the emerging sub-clade including Australia, the UK and Iran. HA 188T is also found in the H7N7 reservoir, as is the syn350G on these Cameroon sequences.

The 457R and syn466G appear together within the H3N8 reservoir and are paired on a particularly interesting set of related horse and dog sequences from Australia. These two changes fall into a domain band that is related to the emerging sub-clade from Australia to the UK.

canineSydney6525_2007_10_14
canineSydney6692_2007_10_15
equineSydney6085_2007_10_10

GeneWurx_UK_December_Emerging_Genetics_v3.xls

. . . . Cameroon10v_00812_7M_2010_03_23 (
. . . . . . . . 100N [UKWhiteChapel4780352_2010_10_26
. . . . . . . . . . . . . . . . with 128D, syn131S, syn210S, 377K],
. . . . . . . . syn137A [UKCambridge118_2010_11_19
. . . . . . . . . . . . . . . . . . . . with syn363G, syn455Q, syn474C,
. . . . . . . . . . . . . . . . NorthCarolina56_2009_12_07
. . . . . . . . . . . . . . . . . . . . with 100N, 377K],
. . . . . . . . 218V [Minnesota04_18M_2010_03_22
. . . . . . . . . . . . . . . . with 165N, 230I, syn346G,
. . . . . . . . . . . . . Pennsylvania14_20M_2009_06_07
. . . . . . . . . . . . . . . . with 158E, 523I],
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G [H7N3, H7N7],
. . . . . . . . . . . [IranShiraz1_2010_02
. . . . . . . . . . . . . . . with 218A, 228R,
. . . . . . . . . . . swThaiCURA4_2009_11
. . . . . . . . . . . . . . . with 226R, syn484N],
. . . . . . . . 377K,
. . . . . . . . 457R [H2N3, H3N8, H4, H5N1, H7N3],
. . . . . . . . . . . . . [swJapanOkinawa2_2005
. . . . . . . . . . . . . . . . . . . with 225G],
. . . . . . . . syn461K [H2N3, H5N1 Human, Civet & Avian, H6N1, H11],
. . . . . . . . . . . . . . . [Iran16273_2009_11_22
. . . . . . . . . . . . . . . . . . . . with syn55L, 226R],
. . . . . . . . syn466G [H2N3, H3N8, H4N8, H6N1, H7N3, H9N2, H10N7],
. . . . . . . . . . . . . . . [cheetahCA30954_2009_11_17
. . . . . . . . . . . . . . . . . . . . with syn169I, 200S])

. . . . Cameroon10v_00751_10M_2010_03_10 (
. . . . . . . . 100N,
. . . . . . . . syn137A,
. . . . . . . . 218V,
. . . . . . . . syn270I,
. . . . . . . . syn343G,
. . . . . . . . syn350G,
. . . . . . . . 377K,
. . . . . . . . 457R,
. . . . . . . . syn461K,
. . . . . . . . syn466G)

NS1 · #20 January 6th, 2011, 06:06 AM

UK Sequences from 2009 Document Transmission of TamiFlu Resistance

2011-01-06

The UK Health Protection Agency released a set of 38 English sequences on 2010-01-04 at GenBank, but not from the current 2010 severe wave. These 38 HA and NA publications are delayed more than one year, covering September 10 to November 25, 2009. No sequences are included from the pandemic wave currently circulating.

65% of the English sequences are cross-linked with HA syn413K and NA syn407V. 225E occurs in 5 sequences and 225G in 2 sequences. Person to person transmission of oseltamivir-resistance via NA H275Y is noted within a hematology unit that encompasses 15 of these 38 sequences. All but one of the anti-viral resistant sequences are on a cross-linked background. One simple drug resistant sequence carries 225G on the cross-linked background.

The drug-resistant 15 are unremarkable, but for their simplicity. The 225G sequences and a representative sample of the anti-viral resistant sequences is presented after the complete listing of TmX sequence names sorted by date.

TamiFlu-Resistance by Date

UKEngland94640080_2009_11_04_xL_TmX
UKEngland94640078_2009_11_05_xL_TmX
UKEngland94740137_2009_11_07_xL_TmX
UKEngland00380009_2009_11_07_xL_TmX
UKEngland94740049_2009_11_10_xL_TmX
UKEngland94740139_2009_11_10_xL_TmX
UKEngland00380013_2009_11_12_xL_TmX
UKEngland94740138_2009_11_16_xL_TmX
UKEngland94740140_2009_11_16_xL_TmX
UKEngland94780019_2009_11_17_xL_TmX
UKEngland00380015_2009_11_17_xL_TmX
UKEngland00380018_2009_11_19_xL_TmX
UKEngland94840152_2009_11_19_TmX
UKEngland00380020_2009_11_20_xL_TmX
UKEngland94840153_2009_11_20_xL_TmX

Representative Sequences

. . . . UKEngland93960032_2009_09_10_xL (
. . . . . . . . 225G,
. . . . . . . . 273A,
. . . . . . . . syn413K)

. . . . UKEngland94640080_2009_11_04_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . 225G,
. . . . . . . . syn413K)

. . . . UKEngland94740049_2009_11_10_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . syn413K,
. . . . . . . . 475N mix wt)

. . . . UKEngland00380018_2009_11_19_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . syn96G,
. . . . . . . . 237I,
. . . . . . . . syn413K)

. . . . UKEngland94840152_2009_11_19_TmX (
. . . . . . . . syn77S)

. . . . UKEngland94840153_2009_11_20_xL_TmX (
. . . . . . . . syn77S,
. . . . . . . . syn331G,
. . . . . . . . syn413K)

NS1 · #21 January 7th, 2011, 05:19 AM

http://pf11.blogspot.com/2011/01/fatal-divergency-on-4-uk-zoonotic.html

** Error on spacing prior to table with sequence name norming **

2011-01-07

Fatal Divergency on 4 UK Zoonotic Sequences

The UK Health Protection Agency released an analysis of the early severe wave today in Eurosurveillance. The requested citation is:

Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760.
Available online:
http://www.eurosurveillance.org/View...rticleId=19760
Date of submission: 31 December 2010

No additional sequences appear to have been released with the paper though a very useful phylogenetic chart is provided as Figure 3: Phylogenetic relationship of full-length HA sequences of influenza A(H1N1)2009 viruses from fatal, severe and mild cases in the United Kingdom during 2010.

All four previously released UK sequences from 2010-12-20 are on the Ellis Figure3 ¹ chart marked as fatality and all four were updated yesterday on GISAID as "Deceased". Two were recent and all four are divergent.

Fatal Sequences from Ellis Figure 3 In GISAID 2010-12-20 Deposit

* UKWhiteChapel4880374_2M_2010_11_28_f	= A/England/4880374/2010
* UKCambridge118_4F_2010_11_19_f	= A/England/118/2010
* UKWhiteChapel4780352_5M_2010_10_26_f	= A/England/4780352/2010
* UKBirmingham3220137_44F_2010_08_07_f	= A/England/3220137/2010

GeneWurx has annotated the Ellis Figure3 ¹ phylogenetic chart with green boxes next to the four fatal GISAID 2010-12-20 deposited sequences and has proposed a 225G branch due to lack of data transparency.

Preliminary Comments on the Ellis Figure 3
(without the essential corroborating sequences)

The numbering system employed in our analyses requires adding 3 to the amino acid positions indicated in the UK chart.

Notice that the branch polymorphisms are not labeled from that top D97N (100N) upwardly.

The accumulation of 100N, 188T, 377K, 225G and 454N patterns onto the OzBrisbane209_51F_2010_08_09 sequence from the late winter in the Southern Hemisphere. Though parameters are adjustable for the phylogenetic chart, the top section may indicate one or more unmarked branches near the top right. Either publication of the sequences or the notation for the branching polymorphism would be very useful at this time. Are these strictly indicative of the high variability head and tail changes being seen frequently (under aa100, over aa499)?

Is it probable that no instance of change at any amino acid position from 156 to 159 has been elucidated from this wide inspection of the severe wave?

Alternate sub-clade:

By chart appearances, the accumulation of 128D onto the more established backgrounds with 100N and 377K (lower section) creates a fatality risk similar to more recognised severity markers. The bottom fatal sequence designated on the lower branch as A/England/4780352/2010 is identified as UKWhiteChapel4780352_2010_10_26_f in v3 of the GeneWurx Emerging Genetics spreadsheet within column AY and carries three additional silent (synonymous) changes at syn58C, syn131S and syn210S.

Hyper-Zoonotic Polymorphism Details

Please excuse the intermediate markings on these sequences. The following are rough lab notes, but divergence may be ascertained easily.

The common ground among these sequences and those in the database on either side of them temporally, from Cameroon (Sub-clade 1 & Sub-clade 2) and especially Iran, is the high quantity of polymorphisms that are novel or rare to pH1N1 and that also appear in zoonotic reservoirs, particularly H3N8, H5N1 and H7N7.

Even small genetic adjustments from animal vectors into human infections, especially H3N8, may create variant behaviour. This potential era of zoonotic sub-segment spillover merits as much investigation for severity (in combination) as does the recognised 225G.

. . . . UKWhiteChapel4880374_2M_2010_11_28_f (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])

. . . . UKCambridge118_4F_2010_11_19_f (
. . . . . . . . syn118E tcatttgaaaggtttgaA,
. . . . . . . . 137T [MoldovaG170_2009,
. . . . . . . . . . . . . 41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L gaagcaactggaaatctG,
. . . . . . . . syn293L gctataaacaccagcctT,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q caAttaaaaaacaatgcc ,
. . . . . . . . syn474C [H3N8],
. . . . . . . . 504G ttaaacagagaagaaatagGt,
. . . . . . . . 513V [1918, S5, tn] Gtttaccagattttggcgatc)

. . . . UKWhiteChapel4780352_5M_2010_10_26_f (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S tcaaacaaaggtgtaacggca,
. . . . . . . . syn210S,
. . . . . . . . 377K)

. . . . UKBirmingham3220137_44F_2010_08_07_f (
. . . . . . . . #8A gcagttctgctatatacattt,
. . . . . . . . 175K aaagtcctcgtgctatgg,
. . . . . . . . 311E Gaaagcacaaaattgaga,
. . . . . . . . 377K,
. . . . . . . . syn385V gtCattgaaaagatgaat,
. . . . . . . . syn451K aagaacttatatgaaaaA,
. . . . . . . . syn454S agTcagttaaaaaacaatgcc,
. . . . . . . . syn494E,
. . . . . . . . 537G [S5] tccctgggggcaatcGgt)

1. Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760. Available online: http://www.eurosurveillance.org/View...rticleId=19760

NS1 · #22 January 7th, 2011, 09:23 AM

The HPA released sequences today at GISAID. 225G only appears twice while instances of 221L and 224K enter the UK geography.

Multiple, hyper-zoonotic sub-clades are circulating with the well-discussed Australian 188T base in place.

Genetic Diversity is the norm.

NS1 · #23 January 7th, 2011, 09:32 AM

A group of the UK sequences appear to be predecessors to Iran. The H3N8 homologies are in place in the UK and Iran while Iran then acquired the H7N7 syn411N. Multi-zoonotic.

Wisconsin08_2010_08_10 has 7 of the same SNPs as IranShahriar5336_2010_12_06. 5 of those 6 are from H3N8 animals.

. . . . IranShahriar5336_2010_12_06 (
. . . . . . . . 137T (aCA) [H3N8 donor aAT, aGT, aGC],
. . . . . . . . 186P,
. . . . . . . . syn297N [H3N8 gadwallRussiaAltai1325_2007_09],
. . . . . . . . . . . . . . . [H5N1],
. . . . . . . . . . . . . . . [Wisconsin08_2010_08_10
. . . . . . . . . . . . . . . . . . . . . . with 39R, syn78S, 137T, 186P, syn297N,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn326S, syn346G, syn388K,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn413K, 444K, syn474C,
. . . . . . . . . . . . . . . CalifVRDL2_2010_01_11
. . . . . . . . . . . . . . . . . . . . . . with syn121P & 502K,
. . . . . . . . . . . . . . . YaroslavlIIV196_2009_12_04_f
. . . . . . . . . . . . . . . . . . . . . . with syn159N, 225G,
. . . . . . . . . . . . . . . WiscD0128_2009_11_15
. . . . . . . . . . . . . . . . . . . . . . with syn343G, 377G, 471H,
. . . . . . . . . . . . . . . Brussels243_2009_11_09
. . . . . . . . . . . . . . . . . . . . . . with syn44L, syn159N & syn323N,
. . . . . . . . . . . . . . . Australia6_2009_07_18
. . . . . . . . . . . . . . . . . . . . . . with syn159N, 233H]
. . . . . . . . syn326S [Wisconsin08_2010_08_10
. . . . . . . . . . . . . . . . . . . . . . with 39R, syn78S, 137T, 186P, syn297N,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn326S, syn346G, syn388K,
. . . . . . . . . . . . . . . . . . . . . . . . . . syn413K, 444K, syn474C,
. . . . . . . . . . . . . . . Zhongyuan1643_2009_11_16
. . . . . . . . . . . . . . . . . . . . . . with 208G],
. . . . . . . . syn383N [H3N8],
. . . . . . . . syn388K [H3N8, H5N1, S7],
. . . . . . . . . . . . . . . [OzVictoria508_2010_07_24
. . . . . . . . . . . . . . . . . . . . . . . with 238D,
. . . . . . . . . . . . . . . swIowa44837_1_2009_11_08_xL
. . . . . . . . . . . . . . . . . . . . . . . with 188R, 225N & 230I,
. . . . . . . . . . . . . . . Utah20_C2_2_2009_07_25_VxX
. . . . . . . . . . . . . . . . . . . . . . . with 159D & 227G, et al],
. . . . . . . . syn411N (AAc) [H7N3 & H7N7 donor ATc],
. . . . . . . . 444K (AAg) [H3N8 gAg],
. . . . . . . . syn474C [H3N8, Avian H1N1 2010],
. . . . . . . . . . . . . . . [Michigan10_2009_06_03 with 137T, 225N, et al])

NS1 · #24 January 7th, 2011, 09:42 AM

158E in a mix found on 188T background. 159K with 128D.

As expected.

NS1 · #25 January 8th, 2011, 01:57 AM

The 377G that is emergent in 2009 Human H5N1 from Dakahlia is also emergent in England and Iran. A recent fatal case from England, UKEngland4500186_2010_11_f, carries the same coding for 377G combined with a 190Y only found elsewhere in 2010 Malmoe Sweden pH1N1 and in Avian H6N1.

The HPA chart of sequences did not notate the 377G branch though 5 English sequences, including this fatal one, appear on the chart carrying the H5N1 Human adaptation.

UKEngland83_2010_10
UKEngland87_2010_10
UKEngland5500192_2010_10
UKEngland119_2010_11
UKEngland4500186_2010_11_f

Data indicates that this disease is rapidly diversifying by accumulating data from multiple animal reservoirs. The most recent UK release is essentially divergent using hyper-zoonoses.

NS1 · #26 January 9th, 2011, 06:32 AM

The UK Health Protection Agency released a group of 37 sequences at GISAID dated 2010-01-05 that appeared sometime after that date. Some of the sequences in this deposit also appear on the Figure 3 Phylogenetic Tree from the HPA Eurosurveilance paper requested to be cited as:

Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760.
Available online:
http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19760
Date of submission: 31 December 2010

The science community expected a full deposit to back the paper, but not all sequences noted on the phylogenetic table were in place at GISAIS as of this 2nd deposit.

The recent GISAID deposit added 4 of the fatalities noted on the phylogenetic tree to the 4 fatalities previously released on 2010-12-20. The previously released sequences were not marked at GISAID with a fatality notation, but now have been notated as "Deceased" as of yesterday. Oddly enough, on the 2010-01-05 deposit, none of the sequences notated as fatal on the phylogenetic tree were marked as to outcome at GISAID?

None of the sequences at the GISAID database that correspond to notated fatalities on the Eurosurveillance paper carry the severity marker of HA 225G.

225G is found on identical HA sequences noted as 2 severe cases.

UKEngland4880378_2010_12
UKEngland4940476_2010_12

The two sequences fall on a 100N, 188T, syn338G, 377K with 454N background. Appended to that background is a silent 179L previously found in US military sequences and as a regional marker in an alternate coding. A silent 448L completes the 225G sequences and is demonstrated in at least on fatal case, including in Russia.

. . . . UKEngland4940476_2010_12 (
. . . . . . . . 100N,
. . . . . . . . syn179L (CTg) [Regional Marker 2009 (tTA)]
. . . . . . . . . . . . . . . . . . . . [TexasAF2588_2009_10_04,
. . . . . . . . . . . . . . . . . . . . TexasJMS404_2010_01_08],
. . . . . . . . 188T,
. . . . . . . . 225G,
. . . . . . . . syn338G,
. . . . . . . . 377K,
. . . . . . . . syn448L [Yakutsk_EAV_2009_11_18,
. . . . . . . . . . . . . . . Yaroslavl_CHMV_2009_11_10_f with 224K & 225G mix],
. . . . . . . . 454N)

. . . . UKEngland4880378_2010_12 (
. . . . . . . . 100N,
. . . . . . . . syn179L,
. . . . . . . . 188T,
. . . . . . . . 225G,
. . . . . . . . syn338G,
. . . . . . . . 377K,
. . . . . . . . syn448L,
. . . . . . . . 454N)

mixin · #27 January 9th, 2011, 04:33 PM

I ran all the HA nucleotides of the UK sequences with gs's program and then grouped them together in a way that looked right. Keep in mind that I'm no scientist. Maybe someone else will see different clades; please feel free to offer opinions.

The severe and fatal cases are marked; notice that about half of them appear on clade B.

Clade A: 451,598,658,1408,1464
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,G1403A,C1408T,C1464T(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,G1403A,C1408T,C1464T(4)

G451A,T598C,T658A,T879C,C1098T,A1172G,G1266A,C1408 T,C1464T,A1568G,G1577T,G1630A(4)
G451A,T598C,T658A,T879C,C1098T,A1172G,G1266A,C1408 T,C1464T,A1568G,G1577T,G1630A(4)
G451A,T598C,T658A,T858C,T879C,C1098T,A1172G,G1266A ,C1408T,C1464T,A1568G,G1577T,G1630A
G451A,T598C,G605A,T658A,A1172G,A1213G,G1266A,C1408 T,C1464T,G1577T,G1630A(4)
G451A,T598C,G610T,T658A,A1172G,G1266A,C1408T,C1464 T,G1577T,G1630A(4) F

G451A,G531A,T598C,T658A,C921T,A1131G,C1408T,C1464T (4)

Clade B: 340,658,1056,1171,1403,1408
G340A,G605C,T658A,T1056C,G1171A,G1403A,C1408T,T165 3C(4)
G340A,G605C,T658A,T1056C,G1171A,G1403A,C1408T,T165 3C(4)
G340A,G605C,T658A,T680C,T1056C,G1171A,G1403A,C1408 T,T1653C(4) F
G340A,G605C,C612T,T658A,T1056C,G1171A,G1403A,C1408 T,T1653C(4)

G340A,A579G,G605C,T658A,C704T,T1056C,G1171A,A1386G ,G1403A,C1408T(4)
G340A,A579G,G605C,T658A,T1056C,G1171A,A1386G,G1403 A,C1408T(4) S
G340A,A579G,G605C,T658A,T1056C,G1171A,A1386G,G1403 A,C1408T(4) S
G340A,A579G,G605C,A611G,T658A,T1056C,G1171A,A1386G ,G1403A,C1408T(4) F
G340A,A579G,G605C,T658A,A716G,T1056C,G1171A,A1386G ,G1403A,C1408T(4) S
G340A,A579G,G605C,T658A,A716G,T1056C,G1171A,A1386G ,G1403A,C1408T(4) S

Clade C: 40,207,605,658,1056,1171,1403,1408,1629
A40G,G207A,G302T,C573A,G605C,T658A,T1056C,G1171A,G 1403A,C1408T,G1629T(4)
A40G,G207A,G515R,G605C,T658A,C816T,T1056C,G1171A,G 1396A,G1403A,C1408T,G1629T(4)
A40G,G340A,A579G,G605C,T658A,C672T,T1056C,G1171A,A 1386G,G1403A,C1408T,G1624A(4)
A40G,G207A,G605C,T658A,T834A,T1056C,G1171A,G1403A, C1408T,G1473A,G1629T(4)
A40G,G207A,G605C,T658A,G832A,T1056C,G1171A,G1403A, C1408T,G1629T(4)
A40G,G207A,G605C,T658A,G1005A,T1056C,G1171A,G1403A ,C1408T,G1629T(4)
A40G,G207A,G605C,T658A,T1056C,G1171A,G1403A,C1408T ,G1629T(4) F
A40G,G207A,G605C,T658A,T1056C,G1171A,C1182T,G1403A ,C1408T,G1629T(4)
A40G,G207A,G605C,T658A,T834A,T1056C,G1171A,G1403A, C1408T,G1629T(4)
A40G,G207A,G605C,T658A,T1056C,G1171A,G1403A,C1408T ,A1435G,G1629T(4) (? F/S)

Odd Ones
C148T,G340A,A424G,A566G,T658A,G684A,C870T,T927C,G1 171A,A1230G,G1326A,C1408T,A1536G(4)
T216C,G340A,A424G,G435A,T658A,C672T,G1171A,C1408T( 4) F
T243C,G340A,A424G,C473T,T658A,G713A,A747G,G1171A,C 1408T,C1627A(4) F
C172T,G360A,A424G,T519A,T658A,G1171A,C1408T(4)
G154A,G207A,G605C,T658A,T1056C,G1171A,C1383A,G1403 A,C1408T,G1524K,G1629T(4)
T17C,G565A,T658A,A973G,G1171A,T1197C,G1395A,C1404T ,C1408T,G1524A,A1651G(4) F
G396A,G451A,G531A,T598C,T658A,A795G,C921T,A1131G,G 1407A,C1408T,C1464T,A1553G,A1579G(4)
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245 T,T1374G,C1408T,C1464T(4)

By areas
1 Coventry
4 Newcastle-upon-tyne
3 Oxford
1 Durham
2 Leeds
1 Manchester
4 Birmingham
1 Leicester
1 York
1 Cambridge (Fatal)
6 London
2 Nottingham
3 Whitechapel (2 Fatal)
1 Middlesex
1 North Yorkshire

8 Severe/fatal with no locations given
1 Possible severe/fatal no location

NS1 · #28 January 9th, 2011, 09:01 PM

Thank you for evaluating these sequences, mixin.

Bear in mind that a program is most useful when the heuristics and assumptions are fully externalised. We are not in receipt of those information points, so our comments here will be given as one in the dark. We've attempted to gain this required insight in the past without success.

From your narrative and the block of output, we can ascertain that the program did some level of data organisation (unstated) and that you then re-arranged parts of the output based on some secondary heuristics.

Does each line represent one sequence and the nucleotide changes on that sequence? Does the program have a method to effectively label those lines with the sequence names (at the beginning and end)? Does any possibility exist to manage ambiguity codes? Does any possibility exist to notate the amino acid positions in parentheses next to the nucleotide positions [e.g. G451A (137T), T1056C (syn338G), et al] or to provide a separate report notated by amino acid position with silent changes differentiated?

Per line, could we see an automated count of the SNPs (silent and non-syn) and have highlighted the SNPs matching the selected sub-clade standards:

Clade A: 451,598,658,1408,1464
G451A,T598C,T658A,T933C,T1020C,T1191C,G1206A,C1245T,T1374G,C1408T,C1464T[x SNPs, x Silent, x Non-syn] (4)

An output format of .csv would increase ease of visualisation if the changes are properly aligned per dataset. Input into a spreadsheet allows additional automated analyses. Output designed for insertion / update into a relational database is even more useful.

Also note that the sequence deposit does not directly match the Ellis Figure 3 Phylogenetic Tree. So overall count and category counts are very dependent on identifying the individual sequence / sample name.

==

At any rate, the output and the post-processing organisation appears to demonstrate that the selected sub-clades demonstrate a lower CFR than the "Odd Ones"? The odd ones, we suggest, are the sequences that do not pattern onto the major groupings using the unstated parameters and hueristics of the program?

If this statement is true concerning the method of selecting the "Odd Ones", then we may conclude that this category has a CFR of 37.5% (3 of 8) as opposed to much lower death rates on the selected larger groups? In fact, the largest suggested sub-clade has the lowest CFR signalling that transmission v. severity are two different concerns with the current circulating reservoir combinations in the UK.

CFR by Suggested Sub-Clade

37.5% - Odd Ones (3 of 8)
20.0% - Clade B (2 of 10)
20.0% - Clade C (1 or 2 of 10)
08.3% - Clade A (1 of 12)

A higher death rate among unpatterned sequences may potentially signal that the hyper-morphic phase has re-initiated. Our analyses indicate that many of the novel and rare changes incoming to PF11 at this time also exist in animal reservoirs that have been previously related to human infection. Small changes in human influenza matching animal genetics are known to create significant changes in severity levels and viral behaviour.

Hyper-morphism (high change rate) with a significant percentage of animal-matched intake equates to a present hyper-zoonotic set of strains.

This hypothesis appears to agree with your data . . . if we are guessing correctly at the underlying parameters.

gsgs · #29 January 9th, 2011, 09:07 PM

I just found this thread.
When will the sequences be published so we can
verify and discuss it freely ?

Earlier attempts to assign differences in virulence to
different substrains had failed.
Remember Argentina last year, Ukraine, early Mexico.

A complete statistic with the proportion of deaths in the
published (or GISAID) substrains would be useful, though.

calculating % of deaths (or ICU) per mutation is straight forward,
then assign the sums of the values to each virus
then calculate the average for each month and chart
it over time, per country,continent

it has been speculated that more middle-age people are infected
this season vs. more children last season.
And the children die less often from ***, more are immune now,
and that that allone could explain the increased number of deaths.

Do we have UK-deaths by age 2009/10 vs. 2010/11 ?

Virologically it's remarkable that these substrains are new,
they emerged from early Cancun viruses, presumably in Asia
and have nothing in common with the strains circulating
in USA,Europe last season.

These mutations do not occur e.g. in my list of 28 substrains
from Nov.2010

NS1 · #30 January 9th, 2011, 10:07 PM

Quote:

Originally Posted by gsgs

I just found this thread.
When will the sequences be published so we can
verify and discuss it freely ?

According to the narrative, these sequences have apparently been
processed through a program of your authorship?

Quote:

Earlier attempts to assign differences in virulence to
different substrains had failed.
Remember Argentina last year, Ukraine, early Mexico.

Clear indications of severity markers and Vaccine Escape domains are available as are indications of drug resistance.

Quote:

A complete statistic with the proportion of deaths in the
published (or GISAID) substrains would be useful, though.

Some outdated material has been produced and analysed to little effect due to scarcity and unreliable parameters.

Quote:

calculating % of deaths (or ICU) per mutation is straight forward,
then assign the sums of the values to each virus
then calculate the average for each month and chart
it over time, per country,continent

Such small point factors are unreliable for many reasons, but, most importantly, due to various synergies among combinations of polymorphisms, some that produce little net effect and others that produce multiplicative effect. The record is observable on these matters.

Calculations based on selected combinations of polymorphisms chosen by frequency / absence on a background among other factors may provide comparisons that feedback to the choice of SNPs to include on that calculation. Due to sparsity of data and clinical meta-data, the calculations must be iterated and interpreted with a high level of earnestness and objectivity.

Quote:

it has been speculated that more middle-age people are infected
this season vs. more children last season.
And the children die less often from ***, more are immune now,
and that that allone could explain the increased number of deaths.

Do we have UK-deaths by age 2009/10 vs. 2010/11 ?

The data have been produced by HPA and provided in spreadsheet format. Transparency and timely reporting is not occurring, nor do we expect valid data in the near term.

GeneWurx_UK_ICU_Categories_v1.xls

Quote:

Virologically it's remarkable that these substrains are new,
they emerged from early Cancun viruses, presumably in Asia
and have nothing in common with the strains circulating
in USA,Europe last season.

These mutations do not occur e.g. in my list of 28 substrains
from Nov.2010

Though novelty and divergency is now the norm in the UK reservoir, one of the strains that was previously found in a robust form during the late Australia winter season is easily trackable.

Emergence began in late 2009 in the United States of the most frequent background and continued via domaining during the early part of 2010 and the summer in the Northern Hemisphere, translating well into the winter in the Southern Hemisphere.

GeneWurx analyses show a pattern of emergence throughout the world of this particular currently low CFR strain. What will happen next may be more predictable should sequences be provided in a timely fashion in conjunction with mild, severe and fatal cases.

GeneWurx_UK_December_Emerging_Genetics_v3.xls