• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

Iran denies bird flu claim

ukcz

New member
Iran denies bird flu claim

Last Modified: 23 May 2006
Source: ITN

Iran has denied reports two dead pneumonia patients tested positive for the H5N1 bird flu virus.

On Monday, an Iranian official said tests on the bodies of a brother and sister showed they had the deadly strain, but health minister Kamran Lankarani has now said the tests were negative.

The Iranian siblings, aged 41 and 26, were among five family members who fell ill. It is not known when they died.

The virus has killed people in neighbouring Turkey, Iraq and Azerbaijan, but Iran has had no confirmed human cases so far.

Iranian scientists first found the H5N1 virus in wild swans in February, and near neighbour Afghanistan has also had outbreaks in poultry.

Mr Lankarani said Iran has tightened its surveillance since cases were detected in neighbouring states.

In Romania, Prime Minister Calin Tariceanu has dismissed allegations that imports of live poultry from Hungary and Slovakia caused a series of bird flu outbreaks across his country.

The country has culled nearly 500,000 birds since discovering its first bird flu case last October, but has not reported any cases in humans.

http://www.channel4.com/news/content/news-storypage.jsp?id=564942
 
Re: Iran denies bird flu claim

Why am I not suprised Iran is saying this?

Personally I believe that these cases are H5N1 and Iran is just doing what every other government has done, deny.
 
Re: Iran denies bird flu claim

Who sent out the memo telling all infected countries to say this after someone confirms the diagnosis? Is this a test of the supposed stupidity of the world? Or, is the entrance exam required as entrance to the flu club? We didn't believe it in Azerbaijan, Egypt, or in parts of Africa, etc,... so why would they think we would believe it now?
 
Re: Iran denies bird flu claim

Deny everything and it all just may go away. At the very least, keep everybody confused and guessing. At least, Iran does not call it "Mystery Flu" like they do in India. They just go for a blank bold faced denial.

They see what we do and then do the same.
 
Last edited by a moderator:
Re: Iran denies bird flu claim

Shannon said:
Who sent out the memo telling all infected countries to say this after someone confirms the diagnosis? Is this a test of the supposed stupidity of the world? Or, is the entrance exam required as entrance to the flu club? We didn't believe it in Azerbaijan, Egypt, or in parts of Africa, etc,... so why would they think we would believe it now?

Ahhhh, but the world believed the story on Malawi when the manna came down from heaven and the villagers had plenty to eat.
 
Re: Iran denies bird flu claim

Another denial today. I wonder what the rumor is referring to--my gut tells me it's not the Kermanshah cluster, though that is in northern Iran too. Strange how they deny ever having bird flu every time--I guess they mean in people, because they admitted it in swans and the sequence is sitting in Pubmed!

http://english.bna.bh/?ID=47206
No bird flu in Iran says official

date: 09 07, 2006

Tehran, July. 9, (BNA) Iranian Minister of Health and Education, Dr. Kamran Baqeri, said that no case of bird flu was yet recorded in Iran.
Dr. Baqeri in a statement to Iran News Agency, stressed that due to the discovery of this virus in neighbouring countries to Iran especially Azerbijan, Turkey and Iran, it is necessary that authorities take the necessary precautions to face this virus. The Iranian official was responding to the rumors that a case was discovered north of the country.
 
Re: Iran denies bird flu claim

MP Rejects Birds Flu Rumors

TEHRAN (Fars News Agency)- Rapporteur of the Parliament's Health and Treatment Commission here on Wednesday strongly rejected observation of human or animal birds flu cases in Iran.

Speaking to FNA, Evaz Heidar-pour said that the official report of the Iranian Health Ministry and the Parliament's Health and Treatment Commission both reiterate that no such cases have ever existed in the country.

"Reliable information and data deny existence of the disease in Iran," he continued.

He said that the Health Ministry is fully prepared to confront the disease, assuring that the Parliament's Health Commission is fully sensitive towards the issue.

The MP reminded that lung and respiratory ailments have always existed in the country, "but signs of such diseases do not imply bird flu epidemic. Some people think that any kind of contagious disease is bird flu and they, unfortunately, start rumors."

Meantime, the parliament deputy assured that if any such case is observed in the country, the public will surely be informed of it, stressing that none of the officials may ever sacrifice public health for economic interests.
 
Re: Iran denies bird flu claim

ISD Nucleotide Record
Accession DQ440535
Gi 89477112
Locus DQ440535
Strain A/swan/Iran/754/2006
Definition Influenza A virus (A/swan/Iran/754/2006(H5N1)) hemagglutinin (HA) gene, partial cds.
Source Influenza A virus (A/swan/Iran/754/2006(H5N1)) ORGANISM Influenzavirus A Influenza A virus (A/swan/Iran/754/2006(H5N1)).
Collection Country Iran (Islamic Republic of)
Length of Sequence 1653
Collection Date (YYYY) 2006
Host Species Avian
Segment 4
Serotype H5N1
Comments [via Genbank record]
Raw Sequence AGTCAGTCTTGTTAAAAGTGATCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACACAAT
AATGGAAAAGAACGTCACTGTTACACACGCCCAAGACATACTGGAAAAGACACACAACGGGAAGCTCTGCGATCT
AGACGGAGTGAAGCCTCTAATTTTAAGAGATTGTAGTGTAGCTGGATGGCTCCTCGGGAACCCAATGTGTGACGA
ATTCCTCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGATCAATCCAGCCAATGACCTCTGTTACCCAGGGAA
TTTCAACGACTATGAAGAACTGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCCCCAA
AAGTTCTTGGTCAGATCATGAAGCCTCATCAGGGGTGAGCTCAGCATGTCCATACCAGGGAAGGTCCTCCTTTTT
TAGAAATGTGGTATGGCTTATCAAAAAGAACGATACATACCCAACAATAAAGAGAAGTTACAATAATACCAACCA
AGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCAAATGATGCGGCAGAGCAGACAAGGCTCTATCAAAACCC
AACCACCTATATTTCCGTTGGGACATCAACACTAAACCAGAGATTGGTACCAAAAATAGCTACTAGATCCAAGGT
AAACGGGCAAAGTGGAAGGATGGAGTTCTTTTGGACAATTTTAAAACCGAATGATGCAATAAACTTTGAGAGTAA
TGGAAATTTCATTGCTCCAGAAAATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATCATGAAAAGTGAATT
GGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAATAGGGGCGATAAACTCTAGTATGCCATTCCACAACAT
CCACCCTCTCACCATCGGAGAATGCCCCAAATATGTGAAATCAAACAGATTAGTCCTTGCGACTGGGCTCAGAAA
TAGCCCTCAAGGAGAGAGAAGAAGAAAAAAGAGAGGACTATTTGGAGCTATAGCAGGTTTTATAGAGGGAGGATG
GCAGGGAATGGTAGATGGTTGGTATGGGTACCACCATAGCAACGAGCAGGGGAGTGGGTACGCTGCAGACAAAGA
ATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAATTCGATCATTGACAAAATGAACACTCAGTTTGA
GGCCGTTGGAAGGGAATTTAATAACTTAGAAAGGAGAATAGAAAATTTAAACAAGAAGATGGAAGACGGATTCCT
AGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAATGAGAGAACTCTAGACTTTCATGACTCAAA
TGTCAAGAACCTTTACGACAAGGTCCGACTACAGCTTAGGGATAATGCAAAGGAGCTTGGTAACGGTTGTTTCGA
GTTCTATCACAGATGCGATAATGAATGTATGGAAAGTGTAAGAAACGGAACGTATGACTACCCGCAGTATTCAGA
AGAAGCAAGATTAAAAAGAGAGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAACTTACCAAATACTGTCAAT
TTATTCAACAGTGGCGAGCTCCCTAGCACTGGCAATCATGGTGGCTGGTCTATCTTTATGGATGTGCTCCAATGG
ATC
GBlink View Genbank Entry (at NCBI)
Reference
Author Capua,I., Safar-Maken,A. and Cattoli,G.
Title Direct Submission
Journal Submitted (09-MAR-2006) Virology, Istituto Zooprofillatico Sperimentale delle Venezie, Viale dell'Universita, 10, Legnaro, PD 35020, Italy
Reference
Author Capua,I., Safar-Maken,A. and Cattoli,G.
Title The hemagglutinin gene of an avian influenza virus H5N1 isolated in Iran
Journal Unpublished
 
Re: Iran denies bird flu claim

JJackson-
You forgot to mark it up. :)

ISD Nucleotide Record
Accession DQ440535
Gi 89477112
Locus DQ440535
Strain
A/swan/Iran/754/2006
Definition Influenza A virus (A/swan/Iran/754/2006(H5N1)) hemagglutinin (HA) gene, partial cds.
Source Influenza A virus
(A/swan/Iran/754/2006(H5N1)) ORGANISM Influenzavirus A Influenza A virus (A/swan/Iran/754/2006(H5N1)).
Collection Country Iran (Islamic Republic of)
Length of Sequence 1653
Collection Date (YYYY) 2006
Host Species Avian
Segment 4

Serotype H5N1
Comments [via Genbank record]
Raw Sequence AGTCAGTCTTGTTAAAAGTGATCAGATTTGCATTGGTTACCATGCAAACA ACTCGACAGAGCAGGTTGACACAAT
AATGGAAAAGAACGTCACTGTTACACACGCCCAAGACATACTGGAAAAGA CACACAACGGGAAGCTCTGCGATCT
AGACGGAGTGAAGCCTCTAATTTTAAGAGATTGTAGTGTAGCTGGATGGC TCCTCGGGAACCCAATGTGTGACGA
ATTCCTCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGATCAATCCAG CCAATGACCTCTGTTACCCAGGGAA
TTTCAACGACTATGAAGAACTGAAACACCTATTGAGCAGAATAAACCATT TTGAGAAAATTCAGATCATCCCCAA
AAGTTCTTGGTCAGATCATGAAGCCTCATCAGGGGTGAGCTCAGCATGTC CATACCAGGGAAGGTCCTCCTTTTT
TAGAAATGTGGTATGGCTTATCAAAAAGAACGATACATACCCAACAATAA AGAGAAGTTACAATAATACCAACCA
AGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCAAATGATGCGGCAG AGCAGACAAGGCTCTATCAAAACCC
AACCACCTATATTTCCGTTGGGACATCAACACTAAACCAGAGATTGGTAC CAAAAATAGCTACTAGATCCAAGGT
AAACGGGCAAAGTGGAAGGATGGAGTTCTTTTGGACAATTTTAAAACCGA ATGATGCAATAAACTTTGAGAGTAA
TGGAAATTTCATTGCTCCAGAAAATGCATACAAAATTGTCAAGAAAGGGG ACTCAACAATCATGAAAAGTGAATT
GGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAATAGGGGCGATAA ACTCTAGTATGCCATTCCACAACAT
CCACCCTCTCACCATCGGAGAATGCCCCAAATATGTGAAATCAAACAGAT TAGTCCTTGCGACTGGGCTCAGAAA
TAGCCCTCAAGGAGAGAGAAGAAGAAAAAAGAGAGGACTATTTGGAGCTA TAGCAGGTTTTATAGAGGGAGGATG
GCAGGGAATGGTAGATGGTTGGTATGGGTACCACCATAGCAACGAGCAGG GGAGTGGGTACGCTGCAGACAAAGA
ATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAATTCGATCA TTGACAAAATGAACACTCAGTTTGA
GGCCGTTGGAAGGGAATTTAATAACTTAGAAAGGAGAATAGAAAATTTAA ACAAGAAGATGGAAGACGGATTCCT
AGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAATGAGA GAACTCTAGACTTTCATGACTCAAA
TGTCAAGAACCTTTACGACAAGGTCCGACTACAGCTTAGGGATAATGCAA AGGAGCTTGGTAACGGTTGTTTCGA
GTTCTATCACAGATGCGATAATGAATGTATGGAAAGTGTAAGAAACGGAA CGTATGACTACCCGCAGTATTCAGA
AGAAGCAAGATTAAAAAGAGAGGAAATAAGTGGAGTAAAATTGGAATCAA TAGGAACTTACCAAATACTGTCAAT
TTATTCAACAGTGGCGAGCTCCCTAGCACTGGCAATCATGGTGGCTGGTC TATCTTTATGGATGTGCTCCAATGG
ATC
GBlink View Genbank Entry (at NCBI)
Reference
Author Capua,I., Safar-Maken,A. and Cattoli,G.
Title Direct Submission
Journal Submitted (09-MAR-2006) Virology, Istituto Zooprofillatico Sperimentale delle Venezie, Viale dell'Universita, 10, Legnaro, PD 35020, Italy
Reference
Author Capua,I., Safar-Maken,A. and Cattoli,G.
Title The hemagglutinin gene of an avian influenza virus H5N1 isolated in Iran
Journal Unpublished
 
Re: Iran denies bird flu claim

hawkeye said:
"Reliable information and data deny existence of the disease in Iran," he continued.

It's getting interesting. :) What's all this unreliable info and data?! THERESA, where are you? We need to translate stuff!
 
Re: Iran denies bird flu claim

vaffie said:
It's getting interesting. :) What's all this unreliable info and data?! THERESA, where are you? We need to translate stuff!
:D

Curiouser and curiouser, indeed. Trouble is, I haven't found a good Farsi-English machine-translator. :( I tried to find one when there were those suspected human cases in Iran, but didn't have any luck. If anyone knows of one, please let us know! (The Arab-English translators sorta work on Farsi, but not really -- you wind up with more gobbledigook than anything else, unfortunately.)

I'm keeping an eye out for a good machine-translator though!
 
Re: Iran denies bird flu claim

Theresa42 said:
:D

Curiouser and curiouser, indeed. Trouble is, I haven't found a good Farsi-English machine-translator. :( I tried to find one when there were those suspected human cases in Iran, but didn't have any luck. If anyone knows of one, please let us know! (The Arab-English translators sorta work on Farsi, but not really -- you wind up with more gobbledigook than anything else, unfortunately.)

I'm keeping an eye out for a good machine-translator though!
Hi Theresa, try looking for anything related to these Ardabil prisoners. Ardabil is in northern Iran--which is what the denials referred to. Additionally, this article is talking about these prisoners having "severe flu", "not being able to move", and "heart attack". If this is referring to paralysis, it could very well be H5N1. H5N1 has a propensity to cause severe myocardial damage that could easily be misinterpreted as a heart attack. I would not be surprised if someone had the "great" idea of infecting a political prisoner with H5N1, believing wrongly that human-human transmission was impossible, only to find that in such a closed space, a bunch of other people were now catching it.

http://www.bakutoday.net/view.php?d=24010
City of Ardabil in Northern Iran: Lives of Azerbaijani prisoners are in danger

21/07/2006 02:41

Flu has spread in a section of Ardabil prison where Azerbaijani activists are held. After recent release of 12 activists, at least 15 more activists have been identified who are still being held in Ardabil prison.


All of them are known to have severe symptoms of flu. The prisoners who were recently released from the same prison tell that prisoners are deprived from medicine and the prison guards do not allow them to be seen by doctors.

Among the prisoners there is a teenager, Hasan Balazadeh, who is a high school student. Despite being under age, he is held with adult prisoners and under the same conditions. 15 year old Hasan Balazadeh is suffering from severe pains related to flu and he is not able to move.

Meanwhile, the hunger strike of well-known Azerbaijani activist, writer and poet, Abbas Lesani continues. He is now refusing to drink any fluids. His family members who have been able to see him after a long time, say that Mr. Lesani is being held in the hospital of Ardabil Prison and his health is in grave condition. The writer has told his family members that despite their insistence he will refuse to even drink water until the justice is served.

Hayat Hoseinpour is another prisoner being held in Ardabil Prison. He suffered a heart-attack 7 days ago and has now become paralyzed and is not able to move his body. Yet he is being denied medical service and is not permitted to be taken to a hospital.

Meanwhile, more Azerbaijani activists in city of Ardabil have been questioned, detained, beaten and tortured in branches of the security agency. Even the 12 prisoners who were freed on bail have been taken to revolutionary courts. Rahim Gholami, Ali Babai, Rahim Khodadadi, Mazaher Mali, and Asghar Akbarzadeh are among them.
 
Back
Top Bottom