• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

A/Illinois/01/2009(H1N1)

Re: A/Illinois/01/2009(H1N1)

LOCUS GQ232028 1701 bp cRNA linear VRL 04-JUN-2009
DEFINITION Influenza A virus (A/Illinois/01/2009(H1N1)) segment 4
hemagglutinin (HA) gene, complete cds.
ACCESSION GQ232028
VERSION GQ232028.1 GI:238867457
DBLINK Project:37813
KEYWORDS .
SOURCE Influenza A virus (A/Illinois/01/2009(H1N1))
ORGANISM Influenza A virus (A/Illinois/01/2009(H1N1))
Viruses; ssRNA negative-strand viruses; Orthomyxoviridae;
Influenzavirus A.
REFERENCE 1 (bases 1 to 1701)
AUTHORS Shu,B., Balish,A., Garten,R., Smith,C., Emery,S., Barnes,J.,
Deyde,V., Klimov,A. and Cox,N.
TITLE Human infection with novel swine H1N1 influenza
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 1701)
AUTHORS Shu,B., Balish,A., Garten,R., Smith,C., Emery,S., Barnes,J.,
Deyde,V., Klimov,A. and Cox,N.
TITLE Direct Submission
JOURNAL Submitted (03-JUN-2009) WHO Collaborating Center for Surveillance,
Epidemiology and Control of Influenza, Influenza Division, Centers
for Disease Control and Prevention, 1600 Clifton Road, N.E.,
Atlanta, GA 30333, USA
COMMENT Swine influenza A (H1N1) virus isolated during human swine flu
outbreak of 2009. For more information, see http://www.cdc.gov/.

Some of the information does not have GenBank feature identifiers
and is being provided in the comment section.

##EpifluData-START##
Isolate A/Illinois/01/2009
Subtype H1N1
Segment_name HA
Host_gender M
Host_age 27
Passage_history C1
Antigen_character A/CALIFORNIA/07/2009-LIKE (H1N1)V
Adamantane_resistance resistant
Zanamivir_resistance sensitive
Oseltamivir_resistance sensitive
Country USA
State/Province Illinois state
Collection_day 24
Collection_month 4
Collection_year 2009
EPI_accession EPI181756
Lineage swl
##EpifluData-END##
FEATURES Location/Qualifiers
source 1..1701
/organism="Influenza A virus (A/Illinois/01/2009(H1N1))"
/mol_type="viral cRNA"
/strain="A/Illinois/01/2009"
/serotype="H1N1"
/host="Homo sapiens; gender M; age 27"
/db_xref="taxon:649866"
/segment="4"
/country="USA: Illinois state"
/collection_date="24-Apr-2009"
gene 1..1701
/gene="HA"
CDS 1..1701
/gene="HA"
/codon_start=1
/product="hemagglutinin"
/protein_id="ACR67185.1"
/db_xref="GI:238867458"
/translation="MKAILVVLLYTFATANADTLCIGYHANNSTDTVDTVLEKNVTVT
HSVNLLEDKHNGKLCKLRGVAPLHLGKCNIAGWILGNPECESLSTASSWSYIVETSSS
DNGTCYPGDFIDYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKS
FYKNLIWLVKKGNSYPKLSKSYINDKGKEVLVLWGIHHPSTSADQQSLYQNADAYVFV
GSSRYSKKFKPEIAIRPKVRDQEGRMNYYWTLVEPGDKITFEATGNLVVPRYAFAMER
NAGSGIIISDTPVHDCNTTCQTPKGAINTSLPFQNIHPITIGKCPKYVKSTKLRLATG
LRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDEI
TNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENER
TLDYHDSNVKNLYEKVRSQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSE
EAKLNREEIDGVKLESTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICI"
ORIGIN
1 atgaaggcaa tactagtagt tctgctatat acatttgcaa ccgcaaatgc agacacatta
61 tgtataggtt atcatgcgaa caattcaaca gacactgtag acacagtact agaaaagaat
121 gtaacagtaa cacactctgt taaccttcta gaagacaagc ataacgggaa actatgcaaa
181 ctaagagggg tagccccatt gcatttgggt aaatgtaaca ttgctggctg gatcctggga
241 aatccagagt gtgaatcact ctccacagca agctcatggt cctacattgt ggaaacatct
301 agttcagaca atggaacgtg ttacccagga gatttcatcg attatgagga gctaagagag
361 caattgagct cagtgtcatc atttgaaagg tttgagatat tccccaagac aagttcatgg
421 cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc ctcatgctgg agcaaaaagc
481 ttctacaaaa atttaatatg gctagttaaa aaaggaaatt catacccaaa gctcagcaaa
541 tcctacatta atgataaagg gaaagaagtc ctcgtgctat ggggcattca ccatccatct
601 actagtgctg accaacaaag tctctatcag aatgcagatg catatgtttt tgtggggtca
661 tcaagataca gcaagaagtt caagccggaa atagcaataa gacccaaagt gagggatcaa
721 gaagggagaa tgaactatta ctggacacta gtagagccgg gagacaaaat aacattcgaa
781 gcaactggaa atctagtggt accgagatat gcattcgcaa tggaaagaaa tgctggatct
841 ggtattatca tttcagatac accagtccac gattgcaata caacttgtca gacacccaag
901 ggtgctataa acaccagcct cccatttcag aatatacatc cgatcacaat tggaaaatgt
961 ccaaaatatg taaaaagcac aaaattgaga ctggccacag gattgaggaa tgtcccgtct
1021 attcaatcta gaggcctatt tggggccatt gccggtttca ttgaaggggg gtggacaggg
1081 atggtagatg gatggtacgg ttatcaccat caaaatgagc aggggtcagg atatgcagcc
1141 gacctgaaga gcacacagaa tgccattgac gagattacta acaaagtaaa ttctgttatt
1201 gaaaagatga atacacagtt cacagcagta ggtaaagagt tcaaccacct ggaaaaaaga
1261 atagagaatt taaataaaaa agttgatgat ggtttcctgg acatttggac ttacaatgcc
1321 gaactgttgg ttctattgga aaatgaaaga actttggact accacgattc aaatgtgaag
1381 aacttatatg aaaaggtaag aagccagcta aaaaacaatg ccaaggaaat tggaaacggc
1441 tgctttgaat tttaccacaa atgcgataac acgtgcatgg aaagtgtcaa aaatgggact
1501 tatgactacc caaaatactc agaggaagca aaattaaaca gagaagaaat agatggggta
1561 aagctggaat caacaaggat ttaccagatt ttggcgatct attcaactgt cgccagttca
1621 ttggtactgg tagtctccct gggggcaatc agtttctgga tgtgctctaa tgggtctcta
1681 cagtgtagaa tatgtattta a
 
Re: A/Illinois/01/2009(H1N1)

Code:
                                       00000000000000011111111111112222 000000000000001111112222 000000000111 0000000000000000000000000000011111111111111111 000000000011111 00000000000000011111111111 0000000000000 0000000000000   
                                       00000000355578900233334567890122 001111234466780017790002 005567899279 0001222233556666777788888899900011222233444566 122333466801123 00222334477789900001122333 1224566688889 0222334466777   
                                       00000117744898516105573731743628 134556905703825860690370 056872033348 0234014978074568112536779902316879188937036614 369099846721442 47448151145844545683523123 8089207911193 9567464557378   
                                       56789122967098130881372791250340 963692700036958911050362 811800606016 4275999831760897693677371401028049923712986485 278167099978383 65073641526665449201510790 9802209656723 4825974693858   
-codon-position------------------------2 12 2  1 111  21  1  1211 12 1  1 2      2    2   2 22   2   1 2   1  11112  11   11  22     1     1  12112121212111   11 1 1  12    1  111  11               1  11   1 2 11  1 1211  21 12   
---Index-------------------------------AGAGATATCGCCGCGTAAGATAAAGTTGAGAG CTAGAGCATCGGCCAGGATCTGCG AGAATCGCGAAG ACGCGCGTGATGGTCGAAAGACTAGAGCGGGGGAGAGCGACCGGTG CTGGTCTGCGGCGGA AAGGAGGGTAAGTACACCGGTTACAT GAGGGGGCACTGG TTCAGAGGGGCAC   


 85 >A/Kansas/03/2009/04/24            .......................G........ ......T................. ..........C. ---..........................----------------- .C...A.....T... ...........A.............. ............A ............T   
 84 >A/Hamburg/4/2009//                .......................G........ ........................ ..........C. ..A........................................... .C...A.....T... ...........A.............. ............. ............T   
256 >A/Illinois/01/2009/04/24          -------------------------------- ..G..................... ------------ .............................................. .C...A.....T... ...........A.............. ------------- .............   
254 >A/NY/1669/2009/04/26              .......................G........ ..G..................... ..........C. .............................................. .C...A.....T... ...........A.............. ............. .............   
250 >A/Oklahoma/02/2009/04/29          -------------------------------- ------------------------ ------------ .............................................. .C...A.....T... -------------------------- ------------- -------------   

---Index-------------------------------AGAGATATCGCCGCGTAAGATAAAGTTGAGAG CTAGAGCATCGGCCAGGATCTGCG AGAATCGCGAAG ACGCGCGTGATGGTCGAAAGACTAGAGCGGGGGAGAGCGACCGGTG CTGGTCTGCGGCGGA AAGGAGGGTAAGTACACCGGTTACAT GAGGGGGCACTGG TTCAGAGGGGCAC   
-codon-position------------------------2 12 2  1 111  21  1  1211 12 1  1 2      2    2   2 22   2   1 2   1  11112  11   11  22     1     1  12112121212111   11 1 1  12    1  111  11               1  11   1 2 11  1 1211  21 12   
                                       00000000000000011111111111112222 000000000000001111112222 000000000111 0000000000000000000000000000011111111111111111 000000000011111 00000000000000011111111111 0000000000000 0000000000000   
                                       00000000355578900233334567890122 001111234466780017790002 005567899279 0001222233556666777788888899900011222233444566 122333466801123 00222334477789900001122333 1224566688889 0222334466777   
                                       00000117744898516105573731743628 134556905703825860690370 056872033348 0234014978074568112536779902316879188937036614 369099846721442 47448151145844545683523123 8089207911193 9567464557378   
                                       56789122967098130881372791250340 963692700036958911050362 811800606016 4275999831760897693677371401028049923712986485 278167099978383 65073641526665449201510790 9802209656723 4825974693858


these mutations T267C(5),C397A(5),G786A(6) are characteristic and not seen elsewhere
suggesting a close relationship of these 5 viruses

Someone may examine the traveling history to find the (Mexican?) location
of common origin.

It still has the 2 markers of the "Northern strain"

see here for the subgroups:
http://h5n1experts.org/forum/showpost.php?p=1117
 
Back
Top Bottom