• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

A "pre-seasonal" hospital outbreak of influenza pneumonia caused by the drift variant A/Victoria/361/2011-like H3N2 viruses, Hong Kong, 2011

tetano

Editor, Senior Moderator
J Clin Virol. 2012 Nov 29. pii: S1386-6532(12)00399-X. doi: 10.1016/j.jcv.2012.11.002. [Epub ahead of print]
A "pre-seasonal" hospital outbreak of influenza pneumonia caused by the drift variant A/Victoria/361/2011-like H3N2 viruses, Hong Kong, 2011.
Chan MC, Lee N, Ngai KL, Wong BC, Lee MK, Choi KW, Lai RW, Chan PK.
Source

Department of Microbiology, Faculty of Medicine, The Chinese University of Hong Kong, Prince of Wales Hospital, Hong Kong Special Administrative Region, People's Republic of China. Electronic address: martin.chan@cuhk.edu.hk.
Abstract
BACKGROUND:

Beginning from late 2011 and early 2012, increasing circulation of antigenically drifted influenza A/Victoria/361/2011-like H3N2 viruses within genotype 3 of the A/Victoria/208/2009 clade have been reported in multiple European countries and elsewhere. Whether these emerging viruses are associated with increased disease severity is unclear.
OBJECTIVES:

To report the clinical and virological findings of a moderately severe hospital outbreak of A/Victoria/361/2011-like viruses that occurred in November 2011 in Hong Kong.
STUDY DESIGN:

Clinical and virological hospital outbreak investigation.
RESULTS:

The outbreak occurred in an adult psychiatric ward in November 2011, a time well before the usual local seasonal influenza winter peak. Altogether, 7 patients and 1 healthcare-worker were affected (mean age, 47 [range, 34-61] years). The attack rates among patients and healthcare-workers were 33% (7/21) and 7% (1/15), respectively. Pneumonia developed in 38% (3/8) of cases; none had underlying immunocompromised conditions. High nasopharyngeal viral loads were detected. All cases responded to antiviral treatment. Multiple amino acid mutations with reference to earlier A(H3N2) vaccine strains were mapped to key antigenic sites on hemagglutinin; however, no critical mutations on receptor binding sites were detected. Viral sequence variations jeopardized the performance of molecular diagnostic assays.
CONCLUSIONS:

Severe disease and pneumonia occurred in a substantial proportion of non-immunocompromised adults in a hospital outbreak attributed to the emerging antigenically drifted A/Victoria/361/2011-like H3N2 viruses. Close monitoring of the transmission of this drift variant is required. Further studies are also necessary to determine virus virulence.

Copyright ? 2012 Elsevier B.V. All rights reserved.

PMID:
23201458
[PubMed - as supplied by publisher]

http://www.ncbi.nlm.nih.gov/pubmed/23201458
 
Re: A "pre-seasonal" hospital outbreak of influenza pneumonia caused by the drift variant A/Victoria/361/2011-like H3N2 viruses, Hong Kong, 2011

..................................

2013.01.14 at genbank:

KC342646 Human 4 H3N2 Hong Kong 2011/11/30 1725 Influenza A virus (A/Hong Kong/CUHK31987/2011(H3N2)) nc
KC342647 Human 6 H3N2 Hong Kong 2011/11/30 1423 Influenza A virus (A/Hong Kong/CUHK31987/2011(H3N2)) c
KC357320


http://www.ncbi.nlm.nih.gov/nuccore/KC342646
http://www.ncbi.nlm.nih.gov/nuccore/KC342647

analysis later ....
 

Attachments

  • 32_11c.gif
    32_11c.gif
    5.6 KB · Views: 1
Re: A "pre-seasonal" hospital outbreak of influenza pneumonia caused by the drift variant A/Victoria/361/2011-like H3N2 viruses, Hong Kong, 2011

most similar to

> A/Singapore/H2011.808bC/2011,2011/10/22(H3N2)

which is number 188 out of 361 in that mutation-picture

file 3212j.l1

attached to file 3212i from 2012/09/11



Code:
                                                               000000000000000000011111111111111112222 000000000000000000111111111111112222 000000000000000111111111111111 0000000000000000000000000000011111111111 000000000000111111 0000000000000000000000011111111111 00000000000 0000000000 
                                                               011223333555667788900012223367888990112 001111111344668999023355667778990122 011333344556888000123333555668 0001111233444555666666777889900111225556 000233566778033344 0001122223444446678888900011112223 11234445556 2334446677 
                                                               168280349245030367822542263869337298091 230145589904250148553636470253550903 925023645163116466825677389880 4674889318588026012468126780805399594677 259000134294334848 7780146780237784632399324900010899 88654692498 4390153803 
                                                               957803689578968513169891705154678022968 835715695757724551112506487696367304 693319346616394208863517349093 6026271287603125952002598123353057468081 712106368600588908 7858927880991593628718594506704100 09741821015 9104634535 
-codon-position------------------------------------------------1 1 1     1          2     1   1      1 1    2   1   1    1      1 11     12                11  2           1  22121       1  11 11  1  2  21          2       1   1    2 1 22 2   1 1 1     12   22  1  1        2  1  1 22 111  
---Index-------------------------------------------------------CCATTAAGTGTTTAATAGGAGAGGCCTAATCAAGATAGG CGACCAGAATATACGCTACGCTCTCAGCGGGCGGCA AGTAAGGCGGCTGAAAAGCACCAAATGTGG GTCAGTCGCCCTCGAAGTAGCAGCAGTTAGCTAGCCCCAA TGAGAATGAGTGCAGTTC TTTTATGAATGGCTAACGGCCATAAGGAGAAAAA GGTTACAGTGC CGGGACCAAA 
   1 >Index/USA-2007                                           ....................................... .................................... .............................. ........................................ .................. .................................. ........... .......... 
   3 >2007/02/06,14278,AUS,A/Brisbane/10/07                    ...............C...GA...T....C......... A.....A..C.....T.....C...........A.. ......................G....... AC.........................C............ ........G......... ......................C......G.... ...C....C.. ........G. 
   4 >Index/Brisbane-like/2007                                 ....................................... .............T....................A. .A..................T..C...... ..................G..................... A.....C.........G. .................................. ........... .......... 
   5 >Index/Perth-like/2009                                    ...C..........G..A...GAA.........A..G.. ....TG...........GT........A.AT...A. ..CG....A.A....GG..........AA. .......A...A..CC.A.....T.......G.A.TTAG. ...A...A......AC.T ........G.AA...G....A..GG......... ..C...GA.AT .A....T... 
   6 >Index/2009/Egypt/Iowa                                    ..G..G........G.GAC..GAA...G........... ..G..G..G.G......G.A...C..AAA...A.AG C.C..AA..........A...T.....G.. ........A...T.CC.G..AG.T.....AAG.A.T.AG. ...ACG............ CCC.G......AT..G............A...G. ..C...GA... ...AG....G 
   2 >A/Hong Kong/CUHK31987/2011/11/30/(H3N2)                  --------------------------------------- ------------------------------------ ------------------------------ ..T.A.T.A.T.TACCAG.TAGAT.AG.GAAGCAAT.AGG ------------------ .....CAG.C.AT.GGTAAT.C...AAC..GT.C ----------- ---------- 
   7 >A/Singapore/H2011.808bC/2011,2011/10/22,H3N2,Singapore   TTG.CGTACACCCG..GAC..GAA.TCGG.TGG.GC.AA TAGT.G.GG.GCG.A.CG.AA.ACACAAA..TA.A. C.C.GAAT.A.CTGG..AAG.T..GAAG.A ..TGACT.AAT.TACC.R.TAGATG.G.GAAGCAAT.AGG .AGACG...TCATG.... ...C.CAG.C.ATCGGTAAT.....AAC..GT.C ATC.GTGA... A.AAGT.G.G 
                                                                                                                                                                                                                                                                                                 
---Index-------------------------------------------------------CCATTAAGTGTTTAATAGGAGAGGCCTAATCAAGATAGG CGACCAGAATATACGCTACGCTCTCAGCGGGCGGCA AGTAAGGCGGCTGAAAAGCACCAAATGTGG GTCAGTCGCCCTCGAAGTAGCAGCAGTTAGCTAGCCCCAA TGAGAATGAGTGCAGTTC TTTTATGAATGGCTAACGGCCATAAGGAGAAAAA GGTTACAGTGC CGGGACCAAA 
-codon-position------------------------------------------------1 1 1     1          2     1   1      1 1    2   1   1    1      1 11     12                11  2           1  22121       1  11 11  1  2  21          2       1   1    2 1 22 2   1 1 1     12   22  1  1        2  1  1 22 111  
                                                               000000000000000000011111111111111112222 000000000000000000111111111111112222 000000000000000111111111111111 0000000000000000000000000000011111111111 000000000000111111 0000000000000000000000011111111111 00000000000 0000000000 
                                                               011223333555667788900012223367888990112 001111111344668999023355667778990122 011333344556888000123333555668 0001111233444555666666777889900111225556 000233566778033344 0001122223444446678888900011112223 11234445556 2334446677 
                                                               168280349245030367822542263869337298091 230145589904250148553636470253550903 925023645163116466825677389880 4674889318588026012468126780805399594677 259000134294334848 7780146780237784632399324900010899 88654692498 4390153803 
                                                               957803689578968513169891705154678022968 835715695757724551112506487696367304 693319346616394208863517349093 6026271287603125952002598123353057468081 712106368600588908 7858927880991593628718594506704100 09741821015 9104634535

---------------------------------------------------

so, this is the "normal" Egypt-Iowa strain that was circulating in 2011, not the reassorted variant
that was also circulating.
We still don't know what it may have in the other 6 segments, and I haven't checked for
possible bad mutations in HA,NA but 4,6 are from the normal Singapore virus.

-----------------------------------------------------
G609A(4),G871A(4),A898C(6)

amino acids: G291S(4)
substract 16 to get the numbering
that most others use
 

Attachments

  • 3212i4a.gif
    3212i4a.gif
    38.7 KB · Views: 1
Back
Top Bottom