• FluTrackers.com Inc. does not provide medical advice. Information on this web site is collected from various internet resources, and the FluTrackers board of directors makes no warranty to the safety, efficacy, correctness or completeness of the information posted on this site by any author or poster. The information collated here is for instructional and/or discussion purposes only and is NOT intended to diagnose or treat any disease, illness, or other medical condition. Every individual reader or poster should seek advice from their personal physician/healthcare practitioner before considering or using any interventions that are discussed on this website. By continuing to access this website you agree to consult your personal physican before using any interventions posted on this website, and you agree to hold harmless FluTrackers.com Inc., the board of directors, the members, and all authors and posters for any effects from use of any medication, supplement, vitamin or other substance, device, intervention, etc. mentioned in posts on this website, or other internet venues referenced in posts on this website.
  • We are not asking for any donations. Do not donate to any entity who says they are raising funds for us.

H7N9 – Discussion, April 1, 2013 to June 3, 2013 (Closed)

Status
Not open for further replies.
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Hat tip: Diane Morin

Opinion

Is This a Pandemic Being Born?

China's mysterious pig, duck, and people deaths could be connected. And that should worry us.

BY LAURIE GARRETT |APRIL 1, 2013
...

On March 25, Chinese authorities seized manufactured pork buns that were found to be made from Zhejiang pigs that had died of the mysterious ailment. The possibly contaminated pork was in the Chinese food supply. By the end of March, at least 20,000 pig carcasses and tens of thousands of ducks and swans had washed upon riverbanks that stretch from the Lake Qinghai area all the way to the East China Sea -- a distance roughly equivalent to the span between Miami and Boston. Nobody knows how many more thousands of birds and pigs have died, but gone uncounted as farmers buried or burned the carcasses to avoid reprimands from authorities.

While environmental clean-up and agricultural authorities scrambled to remove the unsightly corpses and provide the anxious public with less-than-believable explanations for their demise, a seemingly separate human drama was unfolding. On Feb. 19, a man identified by Xinhua, China's state news agency, only as Li, an 87-year old retiree, was hospitalized in Shanghai with severe respiratory distress and pneumonia. On March 4, Li went into severe cardio-respiratory failure and succumbed.
...
According to Chinese authorities, some of the dead pigs tested antibody-positive for circoviruses, or PCV-2, and samples of the virus were isolated from Huangpu River. The implication was that the Shanghai pigs died of PCV-2, a type of virus that is harmless to human beings, as well as birds. Photographs of the carcasses reveal that the animals were large adult hogs, but PCV-2 does not kill adult pigs -- it is lethal to fetuses and newborn piglets.
...
The Chinese health authorities have to date offered no cause of death for the ducks and swans, failed to describe any unusual genetic features that might have turned the PCV-2 into an adult pig-killer virus, and insisted there is no connection between the pigs, people, and birds. Though the surviving woman, Han, had some contact with live chickens, according to Xinhua, neither Li nor Wu had any known contact with birds. Wu has been identified variously as a butcher, meat processor, and employee of a meat plant -- all of which might imply he had contact with pigs.
...
One very plausible explanation for this chain of Chinese events is that the H7N9 virus has undergone a mutation -- perhaps among spring migrating birds around Lake Qinghai. The mutation rendered the virus lethal for domestic ducks and swans. Because many Chinese farmers raise both pigs and ducks, the animals can share water supplies and be in fighting proximity over food -- the spread of flu from ducks to pigs, transforming avian flu into swine flu, has occurred many times. Once influenza adapts to pig cells, it is often possible for the virus to take human-transmissible form. That's precisely what happened in 2009 with the H1N1 swine flu, which spread around the world in a massive, but thankfully not terribly virulent, pandemic.

If the pigs, people, and birds have died in China from H7N9, it is imperative and urgent that the biological connection be made, and extensive research be done to determine how widespread human infection may be...
...
Full text:

http://www.foreignpolicy.com/articl...pandemic_being_born_china_pigs_virus?page=0,3
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

According to Chinese authorities, some of the dead pigs tested antibody-positive for circoviruses, or PCV-2, and samples of the virus were isolated from Huangpu River. The implication was that the Shanghai pigs died of PCV-2, a type of virus that is harmless to human beings, as well as birds. Photographs of the carcasses reveal that the animals were large adult hogs, but PCV-2 does not kill adult pigs -- it is lethal to fetuses and newborn piglets.

That doesn't seem to be true currently. PCV-2 can kill adult pigs.

http://www.flutrackers.com/forum/showpost.php?p=489990&postcount=23

Seems to be evolving more virulence per a couple of 2012 references:

Spread like a wildfire--the omnipresence of porcine circovirus type 2 (PCV2) and its ever-expanding association with diseases in pigs

Identification of an emerging recombinant cluster in porcine circovirus type 2

A duck circovirus has been identified in China, too.
Detection of duck circovirus in China: A proposal on genotype classification

Possible cross-species transmission of circoviruses and cycloviruses among farm animals
 
Last edited:
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Opinion

Bird flu a reminder of things we dare not forget

SCMP Editorial
Wednesday, 03 April, 2013 [Updated: 03:29

...
Mainland authorities say there is no evidence of human-to-human infection, but the virus seems to have mutated and the circumstances are worrying. Two sons of one of the dead men contracted pneumonia and one died, although H7N9 was not found in either of them. The World Health Organisation says it is too early to rule out a link with dead pigs found floating in the Huangpu river, even if tests have not found it.

Hong Kong's secretary for food and health, Dr Ko Wing-man, says it remains important to find out if there has been human-to-human transmission. Tests showing the three did not infect each other raise the possibility of more than one infection source and he says it is also important to look out for epidemics among animals.
...
It took a month and three weeks before we learned of the deaths of the two men with H7N9. In light of the lack of information which left Hong Kong unprepared for Sars, this has prompted questions about the notification system set up to avoid a similar situation.
...
http://www.scmp.com/comment/insight...5/bird-flu-reminder-things-we-dare-not-forget
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Hattip Giuseppe Michieli

World Health Organization
Frequently Asked Questions on human infection with A(H7N9) avian influenza virus, China

Updated 2 April 2013
...
3. Is this infection related to more than 16,000 pig carcasses recently found dumped in rivers around Shanghai?

While the dead pigs were part of the overall investigation, there was no evidence of any connection.
...
http://www.flutrackers.com/forum/showthread.php?t=202771
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Based on the timelines I've seen, the first two cases of H7N9 were contracted in mid- to late-February, but the dead pigs were not reported in the river until a couple of weeks later.

Hattip Giuseppe Michieli

World Health Organization
Frequently Asked Questions on human infection with A(H7N9) avian influenza virus, China

Updated 2 April 2013
...
3. Is this infection related to more than 16,000 pig carcasses recently found dumped in rivers around Shanghai?

While the dead pigs were part of the overall investigation, there was no evidence of any connection.
...
http://www.flutrackers.com/forum/showthread.php?t=202771
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Hattip Giuseppe Michieli

World Health Organization
Frequently Asked Questions on human infection with A(H7N9) avian influenza virus, China

Updated 2 April 2013
...
3. Is this infection related to more than 16,000 pig carcasses recently found dumped in rivers around Shanghai?

While the dead pigs were part of the overall investigation, there was no evidence of any connection.
...
http://www.flutrackers.com/forum/showthread.php?t=202771


From an article I posted last night: http://www.flutrackers.com/forum/showpost.php?p=490020&postcount=56

Shanghai to strengthen the prevention and control of H7N9 avian influenza, the Shanghai Animal CDC today salvaged Huangpu River upstream float the dead pigs sampling Thirty-four retained samples for universal primers detection of avian influenza, avian influenza virus is not found."

Our thread about the dead pigs included reports that there were an estimated 15,000 dead pigs. I'm no statistician but 34 out of 15,000 seems to be an insufficient sample rate. I am curious if the WHO knows what, if any, additional testing was done.

The geographical dispersion of the cases makes it seem unlikely that the dead pigs in the river are the source - unless the virus has also become widespread in swine throughout the region. But, I think that more than 34 samples need to be tested before they can be ruled out.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

they need to check the chickens, not pigs.
Mexico has to check the pigs.
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

you could as well argue that the virus having human markers is a good sign.
It doesn't transmit human to human seapite these markers.
So we needn't worry that it acquires the markers to imoprove
on that as with H5N1.

In poultry it probably circulates since quite some months
but isn't gone HP yet as we saw earlier in several outbreaks.
So it has some potential to go more virulent.

There could be lots of mild human cases without the virulence markers
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Speaking of poultry....

Where is all the culling?

I have not seen one report that mentions any mass cullings.

Case #3 routinely went to a farm to shop for food and is where she possibly selected a chicken ill with H7N9. Where is the quarantine? The cleanup? The mass poultry cullings that are typical in a human outbreak of any avian influenza?

Am I missing something?
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

it's assumed to be LP in chickens
it also has the short cleavage site

we've seen in the past that this often converted to HP after some months, though.

asymptomatic chickens means, it's hard to find
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

While China is grappling with H7N9, here in EU pictures like this are circulating (A&E Crisis in UK, ????): xhttp://www.telegraph.co.uk/active/9967793/Crisis-hospital-sets-up-tent-for-AandE-patients.html

attachment.php


Reasons behind this overcrowded services is not clear... ???
 

Attachments

  • Norfolk-and-Norwic_2525533b.webp
    Norfolk-and-Norwic_2525533b.webp
    31.5 KB · Views: 1
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

HK SFH said that H7N9 virus gene sequences demonstrated that the virus has a 'signature' that indicates its ability to infect human. See main forum post... It remains sensitive to NAI drugs.

Details surfaced yesterday via genetic analysis:

 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

I found an analysis here now:
http://epidemic.bio.ed.ac.uk/influenza_H7N9_analysis

(1) A short deletion (69-73aa) in stalk region of NA protein.
(2) 627 E > K mutation in PB2 sequence, indicative of mammalian adaptation.
(3) Quite a few amino acid substitutions in NP protein. Interestingly,
a recent paper (Bogs et al. 2011) suggests PB2 627 mutation depends on the
origin of NP protein

http://jvi.asm.org/content/85/20/10691.full
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

UN health agency dismiss H7N9 bird flu pandemic fears

Published: 3 Apr 2013 at 19.49 Online news: Asia
...
"Given the fact that we've seen seven confirmed cases, plus there are reports of other cases, it would not be surprising to see additional cases," said Gregory Hartl, spokesman of the WHO's influenza and epidemics division.

"But these would be additional cases, one by one. We have no evidence so far of human-to-human transmission, and without human-to-human transmission, the likelihood or risk of pandemic is low," he told reporters.

"We're a long way away from thinking about a pandemic," he added.
...
"There's no common factor for all the cases," Hartl noted.
...

Full text:
http://www.bangkokpost.com/news/asia/343765/un-health-agency-dismiss-h7n9-bird-flu-pandemic-fears
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Although there is limited evidence (the potential family cluster associated with the deceased 87 year old patient) for human to human transmission, I am concerned by this recent report of a new case-patient. I question the plausibility of this patient acquiring virus from animals while residing in a retirement home.

It is reassuring that no ill health care workers or other residents have been detected in an apparent group residential setting. It raises the issue of undefined host susceptibility factors.

See: http://www.flutrackers.com/forum/showthread.php?t=202794
Post#3

?Patients Yang, male, 67 years old, Hangzhou, a retirement home. On March 25 because of cough, fever and other symptoms to stay at a hospital in Hangzhou, go to the Affiliated Hospital of Zhejiang University School of Medicine; April 2 rescue. In the afternoon of April 2, Zhejiang Province Center for Disease Control reports the patient's specimen test results for the H7N9 avian influenza virus nucleic acid positive.

April 3, the patient specimens were the China CDC influenza central laboratory for review of the H7N9 avian influenza virus nucleic acid positive.?
 
Re: H7N9 ?Discussion

Re: H7N9 –Discussion

I have been having a look at the phyloginic trees (Cladograms) linked to in Gs's post #33. They are broadly in line with analysis on this thread.

They have highlighted A/brambling/Beijing/16/2012 (A/H9N2) as a good match on the internal genes particularly the polymerase complex components (PA, PB1 & PB2). These form a working unit and will often stay together in reassortments as mixing them up is likely to impair their function leaving the resultant strain less viable against existing wild types.
As Gs suggested in post #13 we may have a number of reassortments going on and the bramling's other internals are not quite as close a match but, as Mixin's BLASTs showed, even these were at least 97% homologous.

A/duck/Mongolia/119/2008 (A/H7N9) appears on both the HA and NA lists but is, as noted in my post #10, not as close but I was only looking a H7N9 candidates. The close matches on the H7 are ducks in Zhejiang and Korea and for the N9 strand a duck and some wild birds, also in Korea, so again in line with Gs's suggestion we are looking at a prior reassortment between these lines to form an H7N9 pairing which has not been caught and sequenced.

They also picked up and addressed Mixin's point about one of the 3 released sequences being a bit removed from the other two (see post #10 in this thread).
In all segments A/Shanghai/2/2013 groups with A/Anhui/1/2013 to the exclusion of A/Shanghai/1/2013 but in NP the common ancestor of the 3 is older suggesting perhaps a further reassortment of a more divergent NP gene at some point in one or other of the lineages. This suggests that the A/Shanghai/1/2013 sequence is may the result of a separate zoonosis from a bird lineage with a slightly divergent NP.
The graphic in post #23 in this thread shows the reassortment route that lead to H1N1(2009) and, hopefully, one day we will be able to generate a similar one for this flu.
 
Last edited:
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

Scientists watch new bird virus in China

Does silent virus in poultry occasionally infect humans?

The Associated Press
Posted: Apr 3, 2013 12:04 PM ET

...
"We speculate that when this virus is maintained in poultry the disease will not appear, and similar in pigs, if they are infected, so nobody recognizes the infection in animals around them, then the transmission from animal to human may occur," said Dr. Masato Tashiro, director of the World Health Organization's influenza research centre in Tokyo and one of the specialists who studied the genetic data. "In terms of this phenomenon, it's more problematic."

This behaviour is unlike the virus's more established relative, the virulent H5N1 strain, which set off warnings when it began ravaging poultry across Asia in 2003. H5N1 has since killed 360 people worldwide, mostly after close contact with infected birds.

"In that sense, if this continues to spread throughout China and beyond China, it would be an even bigger problem than with H5N1 in some sense, because with H5N1 you can see evidence of poultry dying, but here you can see this would be more or less a silent virus in poultry species that will occasionally infect humans," said University of Hong Kong microbiologist Malik Peiris, who also examined the information.
...

http://www.cbc.ca/news/health/story/2013/04/03/bird-flu-h7n9.html
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

There are lots of reassortments in H9N2, most of similar segments,
and the polymerases are separated too.
You can see it even in that small mutation table of best ~12 matches which I posted.
That table even has recombinations, which however often looked as errors in the past.
the number of nucleotide-differences in the 8 segments are:
S1-A1:7,14,3,12,35,9,1,2
S1-S2:9,14,3,13,35,9,1,2
(S1=Shanghai/1,A1=Anhui/1,S2=Shanghai/2)
clearly a new segment 5 was grasped and 2,4 look also different from 3,7,8


Code:
                                                          000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111222222222 00000000000000000000000000111111111111111122222222222 00000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111222 0000000000000000000000000000000000000000000111111111111111111111 000000000000000000000000000000000000000001111111111111111111111 00000000000000000000000000000000000000011111111111111111 000000 000000000000000000000000000000000000 
                                                          000111111222333334445555666666677788888889999900000011111112222222333344555555566667777777777778888888899999000011222 01122344455555666677888899122333455667889900000111122 00001111223333344444455677788888999900000111111111222222223333334455555556666677777788888899999001 0000011111222333344455555566667777777888999001122222333344444456 011222223333344455555666677777788888999990000001111222222222334 00001111222222333344445566677788888999900000111122222333 234669 000111122222333344444445566666677777 
                                                          036012459017125690380257144566714634467781338812234600147890123578333634011338915880122457888990112378912459078805148 53433067801116333637134948158068157122061804579113507 15894677110136902369948257703479034901345013346679015677890224672601389992678801113504677900255354 0003604899166124802811477903590014567077157452502338035800569902 507556993456828811469044401134601138047782447781238011235689059 00361133012258145724470134815823489003611367344702444389 380297 167167900123338922355673713457733445 
                                                          699843465403617606594589258169814240344658361473684524600519276721238540058074043031328680258243584357973298162837110 12217357675691036422944787047259412406307913867589784 27164214143876083226802751710001998951229061764767701758795077545163040360076970394231958328109715 6788028768925272157902369330963471051769575132297174880945071793 121587249543460469044328981527873615652826171203512968494946536 69333728104828287621741652140024321063917851806467025563 478107 239481817329130003236816344656706287 
-codon-position-------------------------------------------            1    1                    1             1              1        1                1           1              1       2      1 1  1         1    1                        11  1      1    2   2          1 2        11 1      1      1      1          2      1   2   122  111  11     1  2   2  2 12                 11      11            1        1        1  1            1    1      1         2     2     2      12     2                   1  1  1    1      2   1        21 2        2 21111211111 
---Index--------------------------------------------------AGAGAGGGGGAGATTCCCCCCACTAAATAGTGGTTTGGAAGGCGTCAAAACACACACCAGCTGCGGGCTCGTTACCCTAGAAGCAGACACGCAGGGCAGCGTCCGGTAGATTCGGTA TCACGGGAGCATAGAAGCCCCGTCGGGCGCTGTTCTACCCCATGACCCGCGGG TGTGCTACTTGTAACTGCGGAGCAACATCGACGGGTCTAAGAGGGACCGGCGGGTTGCCCCGTCGCAATCAGGTGGTGGCCCTCCAATGTAGCTAAAA GACTAATACTTCTTCATCACTTACACTGCTCACGACATAACATCCATTCGACGATAAAAAGGAT GCTAAGAGAGGTTCTCTGTAACAGAGAAGGCATTTGTCTCTGCGGCTGCTAAGCTGTAATTCG TACTGGCGTTAACGCGACACATTATTGATACCCTCGTTCTCCCGGTTACCGCAAGA GTGTAA CGCGCAGAGACCGGAGAGAGTAGGAGCCGATGGATA 
   7 >A/swine/Taizhou/5/2008,2008/10/,China,H9N2          GACAG.AT.CG....TT.T.T.AC.CGCTAC.A.AAAA...A.AC.G.G.T..GT.TTG..CATAA....A...T.TA.AG...GAG..TATGAAA..ATACTTACCCTGC....CG ..C...A....GGA...........A.................A.T....... ..C.................G....T.......AA........A................A.........G...............G.........G. .................T..C...C...........G.C.................GGGG...- .T.G.......................................AA.................. ..A....................G...............C................ ..A... ...A.C..A...........................      429    112 ,    416    111       7:>A/swine/Taizhou/5/2008,2008/10/,China,H9N2          
   8 >A/pigeon/Xuzhou/1/2011,2011/01/31,China,H9N2        ..C.GAAATTGAG.CTT.TATGAC.C.CC....CAC.A...A.A..GG.C..A..G....TC.T...TC..CCG...ATA.GA.T..TG.AT.A..TG..ACT..C..A..CT.AC- .TC..A..A.GGGAGGA.T.A..TAAT.A.....TCGTT..GC..TT....T- .AC.T..T....C...ATAA.A.GG.GCTTG..AACTC..AG.AA.TTAAT.AACCA..TA.C....G..GAACA.CAAT.A.TTC.C.CGTTC.TG- .......G....CC.G.T.....TCTC.......G...C...C..TC...G.A......G.A.A A.CG..CAG...C.CAC.AG.A.AGA.G.A.TC..ACACTCA...TC..CGGAT..CGG..A- ..AC.T.A.C.GTT..GA..T.C..CAC.........CT..A..A...TT.T.G.. .C...- TAAATTAGACTGAA..GTG.ATAA..TAAGCAAG.G      302    268 ,    291    263       8:>A/pigeon/Xuzhou/1/2011,2011/01/31,China,H9N2        
   9 >A/chicken/Dawang/1/2011,2011/01/31,China,H9N2       G.C.GAAATTGAG.C.T.TATGAC.C.CC....CAC.A...A.A..GG.C..A.TG....TC.T...TC..CCG...ATA.GA.T..TG.AT.A..TG..ACT..C..A..CT.AC- .TC..A..A.GGGAGGA.T.A..TAAT.A.....TCGTT..GC..TT....T- .A..T..T....C...ATAA.A.GG.GCTCG..AACTC..AG.AA.TTAAT.AACCA..TA.C....G..GAACA.CAAT.A.TTC.C.CGTTC.TG- .......G....CC.G.T.....TC.C.......G...C...C..TC...G.A......G.A.A A.CG..CAG...C.CAC.AG.A.AGA.G.A.TC..ACACTCA...TC..CGGAT..CGG..A- ...C.T.A.C.GTT..GA..T.C..CAC......A..CT..A..A...T.AT.G.. .C...- TAAATTAGACTGAA..GTG.ATAA..TAAGCAAG.G      316    267 ,    305    262       9:>A/chicken/Dawang/1/2011,2011/01/31,China,H9N2       
   3 >A/chicken/Zhejiang/329/2011,2011/03/,China,H9N2     .A...........C..........T.....C...........T................A....A................G.T..........TA.......T...G.G...A..G C..T...T.........T.T.......A.TCT.......T....G..TAT..A ......G........C...........A....A.....GC...AA..T.AT.AA.CA...A...T.GG.TGA.CA.CAATT..TACGC.C.T....GG ...CGGC..CCT..T.G.TT..G.....TCATT..TGA.GTC.TT...TA.T.CCGGGG.A.G. .....T.A.AAA...A......G...G...T...........T....A.......A....... ....A..............A.............C....T................. T..CG. ........................T.........C.      159    126 ,    159    126       3:>A/chicken/Zhejiang/329/2011,2011/03/,China,H9N2     
   5 >A/chicken/Zhejiang/607/2011,2011/06/,China,H9N2     ............G...........C................A.AA.GG....A.TG......A..AT..TA...TT.........AG.................A...........G C..T...T.........T.T...........T............G..T.T..A ...A.C..CCAC.GT.......T........T..........A..G...........T.....TAT..C......A............A.G...G... AGT.G.C..C.T..T.G.TTCC.......CATT..TGA.GTC..T......T.C.GGGG.A.G. .T.GG........T...A..........A.T.C.....................C.C...... .G....T...G....AG....C..C....G.TTC.........A..CG..A.G.AG ...... ...................A....TA.........G      173    116 ,    173    116       5:>A/chicken/Zhejiang/607/2011,2011/06/,China,H9N2     

   4 >A/chicken/Shanghai/C1/2012,2012/01/,China,H9N2      .............C...A......T.....CA......GTT...CT..G....G.....A....A.C.........T...G..T........G.TA..A....T...G.G...A..G C......T.........T.T.......A.TCT.......T....G..TAT..A ...A.C..CCAC.GT.......T......................G...........TT....TAT..C......A............A.G...G..G AGTCGGC.ACCT..T.G.T...G....ATCATTT.TGA.GTC.TT...T..T.CCGGGG.A.G. .T...T...AAA........G..A...G..T..C....C.......AAA...A..A...CC.A .G....T...G....AG....C..C....G.TTC.........A..CG..A.G.AG T...GG ........................T...........      247    143 ,    247    143       4:>A/chicken/Shanghai/C1/2012,2012/01/,China,H9N2      
   6 >A/brambling/Beijing/16/2012,2012/11/07,China,H9N2   ...A...A.....C...A......T..C..C.......GTT.T.......T........A....A.C.........................G.TA..A....T..C..G....... ...T..............T..................T..A............ ...A.C..CCAC.GT.......T..T................A..G............T....TAT.........A............A.G...G... ....G.C.AC.T....A.TT.C.......CATTA.T...GTC..T..C...T.C.TGGG.A.G. .T...............A.........................AA....C............. C....TT............A.C..C....GTT.C.A..A.T......G....G..G T.ACG. .AAATT.GACTG.ACAG.G.AT.A...AAGCAAG.G      236    125 ,    236    125       6:>A/brambling/Beijing/16/2012,2012/11/07,China,H9N2   

   1 >A/chicken/Jiangsu/Q3/2010,2010/02/,China,H9N2       ........................C.............GTT...CT.....G..............T.......TT..........G............T................. ....A....T...........AC.........CC......A.........T.. C.....G........C...............T......GC.......................................................... AGT....G....C..........TCT........G...C...C...C...G.A......G.... .....T...AAA..........G...................T....A.......A......A C............AT...G...C.....A.......C.....T..C.......... .....G ....................................       84     60 ,     84     60       1:>A/chicken/Jiangsu/Q3/2010,2010/02/,China,H9N2       
   2 >A/chicken/Anhui/HF/2010,2010/04/,China,H9N2         ........................C.G...........GTT.........TG.............AT..TA...TT..........G............T................. ....A................AC.........CC......A.........T.. C.....G........C.............T..A.....GC...........A.........A....G...............C..............G .......G....C....T.....TC.........G...C...C..CC...G.A......G.... .....T...AAA..........G...........A.......T....A.......A....... ........C.....T...G.........A.......C.....T..C.......... T...G- ............................--------      149     74 ,    110     65       2:>A/chicken/Anhui/HF/2010,2010/04/,China,H9N2         
  10 >A/equine/Guangxi/3/2011,2011/03/18,China,H9N2       ...........A.................A.AA...A.GTT.......G.......TTG......AT......G............G..TA...T.T.............C...... ....A.A..T...........AC.........CC......G..A......... C.....T........C....G.................GCA.A........A.........A.......T..........T.C............... A........G.......TT........A....TA..GA..T...T..CTA...C.......... .TCGG.C......TCAC...G....AG.A...CCAA...T.A..AT..AC..A.C..G.CC.A ..TCAT..CC....T.G......G.C.G.GT...AA..TCTT.AA...TT....A. .....G .A....A...T...CA...AC....A..A..AA.C.      493    124 ,    493    124      10:>A/equine/Guangxi/3/2011,2011/03/18,China,H9N2       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               

---Index--------------------------------------------------AGAGAGGGGGAGATTCCCCCCACTAAATAGTGGTTTGGAAGGCGTCAAAACACACACCAGCTGCGGGCTCGTTACCCTAGAAGCAGACACGCAGGGCAGCGTCCGGTAGATTCGGTA TCACGGGAGCATAGAAGCCCCGTCGGGCGCTGTTCTACCCCATGACCCGCGGG TGTGCTACTTGTAACTGCGGAGCAACATCGACGGGTCTAAGAGGGACCGGCGGGTTGCCCCGTCGCAATCAGGTGGTGGCCCTCCAATGTAGCTAAAA GACTAATACTTCTTCATCACTTACACTGCTCACGACATAACATCCATTCGACGATAAAAAGGAT GCTAAGAGAGGTTCTCTGTAACAGAGAAGGCATTTGTCTCTGCGGCTGCTAAGCTGTAATTCG TACTGGCGTTAACGCGACACATTATTGATACCCTCGTTCTCCCGGTTACCGCAAGA GTGTAA CGCGCAGAGACCGGAGAGAGTAGGAGCCGATGGATA 
-codon-position-------------------------------------------            1    1                    1             1              1        1                1           1              1       2      1 1  1         1    1                        11  1      1    2   2          1 2        11 1      1      1      1          2      1   2   122  111  11     1  2   2  2 12                 11      11            1        1        1  1            1    1      1         2     2     2      12     2                   1  1  1    1      2   1        21 2        2 21111211111 
                                                          000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111222222222 00000000000000000000000000111111111111111122222222222 00000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111222 0000000000000000000000000000000000000000000111111111111111111111 000000000000000000000000000000000000000001111111111111111111111 00000000000000000000000000000000000000011111111111111111 000000 000000000000000000000000000000000000 
                                                          000111111222333334445555666666677788888889999900000011111112222222333344555555566667777777777778888888899999000011222 01122344455555666677888899122333455667889900000111122 00001111223333344444455677788888999900000111111111222222223333334455555556666677777788888899999001 0000011111222333344455555566667777777888999001122222333344444456 011222223333344455555666677777788888999990000001111222222222334 00001111222222333344445566677788888999900000111122222333 234669 000111122222333344444445566666677777 
                                                          036012459017125690380257144566714634467781338812234600147890123578333634011338915880122457888990112378912459078805148 53433067801116333637134948158068157122061804579113507 15894677110136902369948257703479034901345013346679015677890224672601389992678801113504677900255354 0003604899166124802811477903590014567077157452502338035800569902 507556993456828811469044401134601138047782447781238011235689059 00361133012258145724470134815823489003611367344702444389 380297 167167900123338922355673713457733445 
                                                          699843465403617606594589258169814240344658361473684524600519276721238540058074043031328680258243584357973298162837110 12217357675691036422944787047259412406307913867589784 27164214143876083226802751710001998951229061764767701758795077545163040360076970394231958328109715 6788028768925272157902369330963471051769575132297174880945071793 121587249543460469044328981527873615652826171203512968494946536 69333728104828287621741652140024321063917851806467025563 478107 239481817329130003236816344656706287

reassortment types:
Code:
1a,1a,1a,1a,1.,1.,1.,1a
1b,1b,1b,1b,2.,2.,2.,2a
1b,1b,1b,1b,2.,2.,2.,2a
2a,2a,1c,2.,3.,3.,3.,1b
2a,2b,2.,2.,4.,4a,4.,1b
3a,2a,2.,2.,3.,4a,3.,1b
3a,3.,2.,2.,4.,4b,3.,2a
3b,4.,3.,1b,3.,5a,4.,1c
3b,4.,3.,1b,3.,5a,3.,1c
3b,4.,3.,3.,5.,5b,4.,2b

(genbank only)
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

speculating about a possible reassortment timeline and trying
to make sense of the
7,14,3,12,35,9,1,2
9,14,3,12,35,9,1,2
differences between S1 and S2/A1

(mutation rate:
~6 nucleotides per year in 1,2,3,4
~4 in 5,6
~2 in 7,8)

Code:
   H7N9 wild     H9N2 poultry
      |             |
      |             |
       \           /
       46\       /123578
           \   /
             O
           /-1y\
         |      |
         |      |<---5
         |      |  
         |      |<---2
         |      |    
         |      |      
         |      |      
         |-378->O
        /      -3M
      /            \   
    /                \  
   O                   O
   S1                A1,S2

so the first major wH7N9+pH9N2-->pH7N9 reassortment would have happened ~1 year ago
assuming that the virus is always much more prevalent in poultry than in wild birds or mammals
i.e. wrt. double infections


I'd like to discuss other suggestions ...
 
Re: H7N9 ?Discussion

Re: H7N9 ?Discussion

ahh, now I see a CIDRAP headline:

Two more H7N9 cases cited; virus may be adapting to mammals
Robert Roos News Editor

> as experts said genetic evidence suggests that the virus may be starting to adapt to mammals.

http://www.cidrap.umn.edu/cidrap/content/influenza/avianflu/news/apr0313virus.html

Nancy Cox:
...some molecular signs of possible adaptation in mammals...particular genetic
sequence indicates replication in domestic poultry not wild birds.
...mammalian receptors
its animal source is unknown. in birds or pigs or both, we don't rule out other sources
--------------------------------------------------------
WHO analysis:
signs of adaptation to growth in mammalian species,...bind to mammalian cells...
grow at mammalean temperature
ongoing H7N9 transmission
------------------------------------------------------------
Webby:
This thing doesn't any longer look like a poultry virus.It really looks to me like it's adapted in a
mammalian host somewhere.It's not clear what the mammalian host is, but the likeliest bets
are pigs and humans
------------------------------------------------------------
other experts quoted by Nature
genetic features suggesting that the virus is adapting to mammals
------------------------------------------------------------
Chinese officials and other experts:
the virus probably came from poultry
---------------------------------------------------------------
Peiris not mentioned,quoted


------------------------------------------------

adapting to mammals ? That seems to require a continuous spread
in mammalean hosts.
And in history that required a circulation of years, decades.

they suggest that the 3 marks : E627K(1),Q226L(4),deletion in NA [what else ?] did evolve
in mammals and are spreading ? Well, the deletion presumably does, E627K is
in the H5N1 Qinghai strain, Q226L is in 2 of 3 and often just evolved in the host
as did E627K.

--------------------------------------
I wished those experts would publically discuss with each olther in internet, as we do.
Instead they communicate less efficiently via press statements.
In formulations chosen so laymen journalists understand it.
In statement anxiously and carefully worded, not how you usually talk with friends,collegues in debates.
----------------------------------------
I also feel that the whole process of truth-seeking in flublogia is less advanced and productive
than what I used to see in math an computer forums before I entered flublogia.
Where are the expert flubies sitting together in one thread and discussing their theories ?
Some tweet, some collect news, some post press-releases, some post monologues in blogs
or forums that very few people read. Rarely you find them discussing with each other.
Merge the flubie communication gateways.
 
Status
Not open for further replies.
Back
Top Bottom